ID: 1066957621

View in Genome Browser
Species Human (GRCh38)
Location 10:42188051-42188073
Sequence AGTTAACTGGAGAAGATGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066957621_1066957625 15 Left 1066957621 10:42188051-42188073 CCGGTCATCTTCTCCAGTTAACT No data
Right 1066957625 10:42188089-42188111 GACAGCTCTTGTCCTATACTGGG No data
1066957621_1066957626 24 Left 1066957621 10:42188051-42188073 CCGGTCATCTTCTCCAGTTAACT No data
Right 1066957626 10:42188098-42188120 TGTCCTATACTGGGCTTTTGTGG No data
1066957621_1066957624 14 Left 1066957621 10:42188051-42188073 CCGGTCATCTTCTCCAGTTAACT No data
Right 1066957624 10:42188088-42188110 AGACAGCTCTTGTCCTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066957621 Original CRISPR AGTTAACTGGAGAAGATGAC CGG (reversed) Intergenic
No off target data available for this crispr