ID: 1066957661

View in Genome Browser
Species Human (GRCh38)
Location 10:42188367-42188389
Sequence CCCCATGAGGTCATCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066957661_1066957666 7 Left 1066957661 10:42188367-42188389 CCAGCACTGATGACCTCATGGGG No data
Right 1066957666 10:42188397-42188419 TTTGAGCAGTTGACACAGGAAGG No data
1066957661_1066957667 8 Left 1066957661 10:42188367-42188389 CCAGCACTGATGACCTCATGGGG No data
Right 1066957667 10:42188398-42188420 TTGAGCAGTTGACACAGGAAGGG No data
1066957661_1066957671 23 Left 1066957661 10:42188367-42188389 CCAGCACTGATGACCTCATGGGG No data
Right 1066957671 10:42188413-42188435 AGGAAGGGAGGACTAGGGCCTGG No data
1066957661_1066957664 3 Left 1066957661 10:42188367-42188389 CCAGCACTGATGACCTCATGGGG No data
Right 1066957664 10:42188393-42188415 TGCCTTTGAGCAGTTGACACAGG No data
1066957661_1066957668 11 Left 1066957661 10:42188367-42188389 CCAGCACTGATGACCTCATGGGG No data
Right 1066957668 10:42188401-42188423 AGCAGTTGACACAGGAAGGGAGG No data
1066957661_1066957669 17 Left 1066957661 10:42188367-42188389 CCAGCACTGATGACCTCATGGGG No data
Right 1066957669 10:42188407-42188429 TGACACAGGAAGGGAGGACTAGG No data
1066957661_1066957670 18 Left 1066957661 10:42188367-42188389 CCAGCACTGATGACCTCATGGGG No data
Right 1066957670 10:42188408-42188430 GACACAGGAAGGGAGGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066957661 Original CRISPR CCCCATGAGGTCATCAGTGC TGG (reversed) Intergenic
No off target data available for this crispr