ID: 1066961386

View in Genome Browser
Species Human (GRCh38)
Location 10:42230783-42230805
Sequence GTAGGGCCAAGGCCAAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066961373_1066961386 14 Left 1066961373 10:42230746-42230768 CCAGTGTACAGCCAGGCCAGGGT No data
Right 1066961386 10:42230783-42230805 GTAGGGCCAAGGCCAAGGTGGGG No data
1066961369_1066961386 29 Left 1066961369 10:42230731-42230753 CCAGGGTAGAAAAGGCCAGTGTA No data
Right 1066961386 10:42230783-42230805 GTAGGGCCAAGGCCAAGGTGGGG No data
1066961376_1066961386 3 Left 1066961376 10:42230757-42230779 CCAGGCCAGGGTAGGAAAAGGCC No data
Right 1066961386 10:42230783-42230805 GTAGGGCCAAGGCCAAGGTGGGG No data
1066961378_1066961386 -2 Left 1066961378 10:42230762-42230784 CCAGGGTAGGAAAAGGCCATGGT No data
Right 1066961386 10:42230783-42230805 GTAGGGCCAAGGCCAAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066961386 Original CRISPR GTAGGGCCAAGGCCAAGGTG GGG Intergenic
No off target data available for this crispr