ID: 1066962746

View in Genome Browser
Species Human (GRCh38)
Location 10:42236036-42236058
Sequence CCTGGCACGGAGCAGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066962735_1066962746 29 Left 1066962735 10:42235984-42236006 CCCGCAGCGAGGCAAGTCATGGT No data
Right 1066962746 10:42236036-42236058 CCTGGCACGGAGCAGCTGGGCGG No data
1066962736_1066962746 28 Left 1066962736 10:42235985-42236007 CCGCAGCGAGGCAAGTCATGGTG No data
Right 1066962746 10:42236036-42236058 CCTGGCACGGAGCAGCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066962746 Original CRISPR CCTGGCACGGAGCAGCTGGG CGG Intergenic
No off target data available for this crispr