ID: 1066963604

View in Genome Browser
Species Human (GRCh38)
Location 10:42242298-42242320
Sequence TATGGAGCAGTCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066963604_1066963611 -5 Left 1066963604 10:42242298-42242320 CCGGCGGCGGCGACTGCTCCATA No data
Right 1066963611 10:42242316-42242338 CCATATCCACGGGGTCCGGGCGG No data
1066963604_1066963617 29 Left 1066963604 10:42242298-42242320 CCGGCGGCGGCGACTGCTCCATA No data
Right 1066963617 10:42242350-42242372 AGTTAAAGGTCCCGCCAGCTAGG No data
1066963604_1066963614 15 Left 1066963604 10:42242298-42242320 CCGGCGGCGGCGACTGCTCCATA No data
Right 1066963614 10:42242336-42242358 CGGCGTCCGCCTCGAGTTAAAGG No data
1066963604_1066963609 -8 Left 1066963604 10:42242298-42242320 CCGGCGGCGGCGACTGCTCCATA No data
Right 1066963609 10:42242313-42242335 GCTCCATATCCACGGGGTCCGGG No data
1066963604_1066963608 -9 Left 1066963604 10:42242298-42242320 CCGGCGGCGGCGACTGCTCCATA No data
Right 1066963608 10:42242312-42242334 TGCTCCATATCCACGGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066963604 Original CRISPR TATGGAGCAGTCGCCGCCGC CGG (reversed) Intergenic
No off target data available for this crispr