ID: 1066963632

View in Genome Browser
Species Human (GRCh38)
Location 10:42242439-42242461
Sequence GCGGGTGCGCGCGCGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066963632_1066963651 24 Left 1066963632 10:42242439-42242461 CCCCCAACCGCGCGCGCACCCGC No data
Right 1066963651 10:42242486-42242508 GCGCCCCGCCTCGCGCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066963632 Original CRISPR GCGGGTGCGCGCGCGGTTGG GGG (reversed) Intergenic