ID: 1066963854

View in Genome Browser
Species Human (GRCh38)
Location 10:42243272-42243294
Sequence CGGCAAAAAGCCGCGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066963854_1066963860 6 Left 1066963854 10:42243272-42243294 CCTGCCACCGCGGCTTTTTGCCG No data
Right 1066963860 10:42243301-42243323 GCCGCGGCTTTTTGACGCCGCGG No data
1066963854_1066963863 27 Left 1066963854 10:42243272-42243294 CCTGCCACCGCGGCTTTTTGCCG No data
Right 1066963863 10:42243322-42243344 GGCTTTTTGCCCCCACCCCCCGG No data
1066963854_1066963857 -10 Left 1066963854 10:42243272-42243294 CCTGCCACCGCGGCTTTTTGCCG No data
Right 1066963857 10:42243285-42243307 CTTTTTGCCGTGCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066963854 Original CRISPR CGGCAAAAAGCCGCGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr