ID: 1066964625

View in Genome Browser
Species Human (GRCh38)
Location 10:42251562-42251584
Sequence CAACATAAACATACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066964623_1066964625 9 Left 1066964623 10:42251530-42251552 CCTAATAAACAACTGGTTGCTCT No data
Right 1066964625 10:42251562-42251584 CAACATAAACATACAGAGCTGGG No data
1066964620_1066964625 22 Left 1066964620 10:42251517-42251539 CCTTTTTGGCCATCCTAATAAAC No data
Right 1066964625 10:42251562-42251584 CAACATAAACATACAGAGCTGGG No data
1066964622_1066964625 13 Left 1066964622 10:42251526-42251548 CCATCCTAATAAACAACTGGTTG No data
Right 1066964625 10:42251562-42251584 CAACATAAACATACAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066964625 Original CRISPR CAACATAAACATACAGAGCT GGG Intergenic
No off target data available for this crispr