ID: 1066966479

View in Genome Browser
Species Human (GRCh38)
Location 10:42270944-42270966
Sequence CTGCTTTTGGTGAAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066966479_1066966481 24 Left 1066966479 10:42270944-42270966 CCTTTTTTCTTCACCAAAAGCAG No data
Right 1066966481 10:42270991-42271013 AATGACCCTTGAATGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066966479 Original CRISPR CTGCTTTTGGTGAAGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr