ID: 1066966787

View in Genome Browser
Species Human (GRCh38)
Location 10:42274202-42274224
Sequence GGAGAATCTCCTTGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066966787_1066966790 23 Left 1066966787 10:42274202-42274224 CCTGTTATTCAAGGAGATTCTCC No data
Right 1066966790 10:42274248-42274270 TCTTGTTAGACTGTTTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066966787 Original CRISPR GGAGAATCTCCTTGAATAAC AGG (reversed) Intergenic
No off target data available for this crispr