ID: 1066966858

View in Genome Browser
Species Human (GRCh38)
Location 10:42275384-42275406
Sequence CATCATCTCTTAAAAGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066966856_1066966858 21 Left 1066966856 10:42275340-42275362 CCATATAACTATAAAAATATTAT No data
Right 1066966858 10:42275384-42275406 CATCATCTCTTAAAAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066966858 Original CRISPR CATCATCTCTTAAAAGTCAG TGG Intergenic
No off target data available for this crispr