ID: 1066967704

View in Genome Browser
Species Human (GRCh38)
Location 10:42284563-42284585
Sequence GTTCTAAGTGTATGACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066967704_1066967706 5 Left 1066967704 10:42284563-42284585 CCAGATTGTCATACACTTAGAAC No data
Right 1066967706 10:42284591-42284613 AATATATAGCCTTCTTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066967704 Original CRISPR GTTCTAAGTGTATGACAATC TGG (reversed) Intergenic
No off target data available for this crispr