ID: 1066975518

View in Genome Browser
Species Human (GRCh38)
Location 10:42364909-42364931
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066975515_1066975518 -7 Left 1066975515 10:42364893-42364915 CCATGCTCCAGGAGAAACTATGC No data
Right 1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG No data
1066975511_1066975518 24 Left 1066975511 10:42364862-42364884 CCCTCATCCTGATCGCTTAAGTG No data
Right 1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG No data
1066975513_1066975518 17 Left 1066975513 10:42364869-42364891 CCTGATCGCTTAAGTGCTCAATG No data
Right 1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG No data
1066975509_1066975518 28 Left 1066975509 10:42364858-42364880 CCCACCCTCATCCTGATCGCTTA No data
Right 1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG No data
1066975512_1066975518 23 Left 1066975512 10:42364863-42364885 CCTCATCCTGATCGCTTAAGTGC No data
Right 1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG No data
1066975510_1066975518 27 Left 1066975510 10:42364859-42364881 CCACCCTCATCCTGATCGCTTAA No data
Right 1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066975518 Original CRISPR ACTATGCTATGCCCCAGTGA GGG Intergenic