ID: 1066975518 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:42364909-42364931 |
| Sequence | ACTATGCTATGCCCCAGTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 6 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1066975515_1066975518 | -7 | Left | 1066975515 | 10:42364893-42364915 | CCATGCTCCAGGAGAAACTATGC | No data | ||
| Right | 1066975518 | 10:42364909-42364931 | ACTATGCTATGCCCCAGTGAGGG | No data | ||||
| 1066975511_1066975518 | 24 | Left | 1066975511 | 10:42364862-42364884 | CCCTCATCCTGATCGCTTAAGTG | No data | ||
| Right | 1066975518 | 10:42364909-42364931 | ACTATGCTATGCCCCAGTGAGGG | No data | ||||
| 1066975513_1066975518 | 17 | Left | 1066975513 | 10:42364869-42364891 | CCTGATCGCTTAAGTGCTCAATG | No data | ||
| Right | 1066975518 | 10:42364909-42364931 | ACTATGCTATGCCCCAGTGAGGG | No data | ||||
| 1066975509_1066975518 | 28 | Left | 1066975509 | 10:42364858-42364880 | CCCACCCTCATCCTGATCGCTTA | No data | ||
| Right | 1066975518 | 10:42364909-42364931 | ACTATGCTATGCCCCAGTGAGGG | No data | ||||
| 1066975512_1066975518 | 23 | Left | 1066975512 | 10:42364863-42364885 | CCTCATCCTGATCGCTTAAGTGC | No data | ||
| Right | 1066975518 | 10:42364909-42364931 | ACTATGCTATGCCCCAGTGAGGG | No data | ||||
| 1066975510_1066975518 | 27 | Left | 1066975510 | 10:42364859-42364881 | CCACCCTCATCCTGATCGCTTAA | No data | ||
| Right | 1066975518 | 10:42364909-42364931 | ACTATGCTATGCCCCAGTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1066975518 | Original CRISPR | ACTATGCTATGCCCCAGTGA GGG | Intergenic | ||