ID: 1066975624

View in Genome Browser
Species Human (GRCh38)
Location 10:42365640-42365662
Sequence CTGGGAGGTGAGGATGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066975616_1066975624 17 Left 1066975616 10:42365600-42365622 CCAGCTGCTCCGGAGGCTGAGGC 0: 167
1: 9963
2: 205381
3: 261275
4: 182404
Right 1066975624 10:42365640-42365662 CTGGGAGGTGAGGATGCAGTGGG No data
1066975612_1066975624 26 Left 1066975612 10:42365591-42365613 CCTGTAATCCCAGCTGCTCCGGA 0: 74
1: 5021
2: 117120
3: 260318
4: 244861
Right 1066975624 10:42365640-42365662 CTGGGAGGTGAGGATGCAGTGGG No data
1066975617_1066975624 8 Left 1066975617 10:42365609-42365631 CCGGAGGCTGAGGCAAGAAAATC No data
Right 1066975624 10:42365640-42365662 CTGGGAGGTGAGGATGCAGTGGG No data
1066975614_1066975624 18 Left 1066975614 10:42365599-42365621 CCCAGCTGCTCCGGAGGCTGAGG 0: 162
1: 11051
2: 225767
3: 280227
4: 178310
Right 1066975624 10:42365640-42365662 CTGGGAGGTGAGGATGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066975624 Original CRISPR CTGGGAGGTGAGGATGCAGT GGG Intergenic
No off target data available for this crispr