ID: 1066976426

View in Genome Browser
Species Human (GRCh38)
Location 10:42372236-42372258
Sequence ATACCCATCCAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066976425_1066976426 3 Left 1066976425 10:42372210-42372232 CCATGAAAAAAGAAATCTAACAA No data
Right 1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066976426 Original CRISPR ATACCCATCCAGAAGAGTGA AGG Intergenic
No off target data available for this crispr