ID: 1066978574

View in Genome Browser
Species Human (GRCh38)
Location 10:42390988-42391010
Sequence GGAAACTCCCTCACCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066978574_1066978580 -7 Left 1066978574 10:42390988-42391010 CCTGGAGAGGTGAGGGAGTTTCC No data
Right 1066978580 10:42391004-42391026 AGTTTCCCTTGGGGTTATCGGGG No data
1066978574_1066978585 17 Left 1066978574 10:42390988-42391010 CCTGGAGAGGTGAGGGAGTTTCC No data
Right 1066978585 10:42391028-42391050 GCTTTTGTGTAACTGACTTTTGG No data
1066978574_1066978581 -6 Left 1066978574 10:42390988-42391010 CCTGGAGAGGTGAGGGAGTTTCC No data
Right 1066978581 10:42391005-42391027 GTTTCCCTTGGGGTTATCGGGGG No data
1066978574_1066978579 -8 Left 1066978574 10:42390988-42391010 CCTGGAGAGGTGAGGGAGTTTCC No data
Right 1066978579 10:42391003-42391025 GAGTTTCCCTTGGGGTTATCGGG No data
1066978574_1066978582 -5 Left 1066978574 10:42390988-42391010 CCTGGAGAGGTGAGGGAGTTTCC No data
Right 1066978582 10:42391006-42391028 TTTCCCTTGGGGTTATCGGGGGG No data
1066978574_1066978578 -9 Left 1066978574 10:42390988-42391010 CCTGGAGAGGTGAGGGAGTTTCC No data
Right 1066978578 10:42391002-42391024 GGAGTTTCCCTTGGGGTTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066978574 Original CRISPR GGAAACTCCCTCACCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr