ID: 1066979589 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:42399911-42399933 |
Sequence | TCTTCCTGGGGAGCTTCCCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1066979589_1066979594 | 21 | Left | 1066979589 | 10:42399911-42399933 | CCAGGGGAAGCTCCCCAGGAAGA | No data | ||
Right | 1066979594 | 10:42399955-42399977 | CTCCTTTGACAGGTCAAGATTGG | No data | ||||
1066979589_1066979593 | 11 | Left | 1066979589 | 10:42399911-42399933 | CCAGGGGAAGCTCCCCAGGAAGA | No data | ||
Right | 1066979593 | 10:42399945-42399967 | TATTCATGAACTCCTTTGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1066979589 | Original CRISPR | TCTTCCTGGGGAGCTTCCCC TGG (reversed) | Intergenic | ||