ID: 1066979589

View in Genome Browser
Species Human (GRCh38)
Location 10:42399911-42399933
Sequence TCTTCCTGGGGAGCTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066979589_1066979594 21 Left 1066979589 10:42399911-42399933 CCAGGGGAAGCTCCCCAGGAAGA No data
Right 1066979594 10:42399955-42399977 CTCCTTTGACAGGTCAAGATTGG No data
1066979589_1066979593 11 Left 1066979589 10:42399911-42399933 CCAGGGGAAGCTCCCCAGGAAGA No data
Right 1066979593 10:42399945-42399967 TATTCATGAACTCCTTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066979589 Original CRISPR TCTTCCTGGGGAGCTTCCCC TGG (reversed) Intergenic