ID: 1066980006

View in Genome Browser
Species Human (GRCh38)
Location 10:42404169-42404191
Sequence GGTAACACCCTCTCATCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066980006_1066980010 17 Left 1066980006 10:42404169-42404191 CCATTAGATGAGAGGGTGTTACC No data
Right 1066980010 10:42404209-42404231 ATGCCAGAGAAAATAGGTTTTGG No data
1066980006_1066980009 11 Left 1066980006 10:42404169-42404191 CCATTAGATGAGAGGGTGTTACC No data
Right 1066980009 10:42404203-42404225 GCATTAATGCCAGAGAAAATAGG No data
1066980006_1066980012 21 Left 1066980006 10:42404169-42404191 CCATTAGATGAGAGGGTGTTACC No data
Right 1066980012 10:42404213-42404235 CAGAGAAAATAGGTTTTGGAAGG No data
1066980006_1066980013 27 Left 1066980006 10:42404169-42404191 CCATTAGATGAGAGGGTGTTACC No data
Right 1066980013 10:42404219-42404241 AAATAGGTTTTGGAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066980006 Original CRISPR GGTAACACCCTCTCATCTAA TGG (reversed) Intergenic
No off target data available for this crispr