ID: 1066980429

View in Genome Browser
Species Human (GRCh38)
Location 10:42408698-42408720
Sequence GACACTGTCACTTTAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 11, 3: 68, 4: 421}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066980429_1066980430 -6 Left 1066980429 10:42408698-42408720 CCATTTTTTAAAGTGACAGTGTC 0: 1
1: 0
2: 11
3: 68
4: 421
Right 1066980430 10:42408715-42408737 AGTGTCTCATTATGTTGCCAAGG No data
1066980429_1066980433 19 Left 1066980429 10:42408698-42408720 CCATTTTTTAAAGTGACAGTGTC 0: 1
1: 0
2: 11
3: 68
4: 421
Right 1066980433 10:42408740-42408762 GGAGTGCAATAGCTATTTACAGG 0: 1
1: 10
2: 109
3: 669
4: 1218
1066980429_1066980431 -2 Left 1066980429 10:42408698-42408720 CCATTTTTTAAAGTGACAGTGTC 0: 1
1: 0
2: 11
3: 68
4: 421
Right 1066980431 10:42408719-42408741 TCTCATTATGTTGCCAAGGCTGG 0: 20
1: 1216
2: 15479
3: 62148
4: 147459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066980429 Original CRISPR GACACTGTCACTTTAAAAAA TGG (reversed) Intergenic
900742292 1:4338118-4338140 GGCACTGTCCCTTTAGTAAAAGG - Intergenic
901397342 1:8990989-8991011 GACCCTGTCTCTACAAAAAATGG + Intergenic
904137531 1:28325322-28325344 GACCCTGTCTCTACAAAAAAAGG + Intergenic
904164912 1:28548036-28548058 GACACTCTGTCTTAAAAAAATGG - Intergenic
905678754 1:39850481-39850503 GACCCTGTCTCTTCAAAAAGGGG + Intronic
906750943 1:48259269-48259291 GCAACTGTCATTTTAAAAAATGG - Intergenic
907131951 1:52104963-52104985 GACACAGTCCCTTGAAACAAGGG - Intergenic
907901930 1:58749000-58749022 GCCACTGTCACCATAAAAAAAGG + Intergenic
908104490 1:60827556-60827578 GACACTGTCTCAAAAAAAAAAGG - Intergenic
908139327 1:61167319-61167341 AAAACTTTCACTTTAAAATAAGG + Intronic
908194664 1:61737134-61737156 GACCCTGTCTCTACAAAAAATGG - Intergenic
908275015 1:62461504-62461526 GACTCTGTCACTATAAAATTAGG + Intronic
908286887 1:62614829-62614851 GAAACTGTGACTTTAAGAGAAGG + Intronic
908345086 1:63224486-63224508 GACCCTGTCGCTACAAAAAAAGG + Intergenic
908724484 1:67160688-67160710 GACCTTGTCTCTTAAAAAAAAGG - Intronic
909181600 1:72430808-72430830 AATACTACCACTTTAAAAAATGG + Intergenic
909497851 1:76299439-76299461 GTCACTGCAACTTTAAAAAGGGG + Intronic
909551535 1:76903447-76903469 GATGCTGTCACTTTGGAAAATGG + Intronic
911111997 1:94198966-94198988 GACACTGGGGCTTTATAAAAAGG + Intronic
911314083 1:96334768-96334790 GACACAGTCACAGCAAAAAAAGG - Intergenic
912312521 1:108638084-108638106 GACACTGTCTCTCTTAAAAAAGG - Exonic
912389589 1:109293431-109293453 GACAGTATCGCTTTTAAAAATGG + Intronic
912902952 1:113672298-113672320 GACCCTGTCACAGTGAAAAATGG - Intronic
915301910 1:154956560-154956582 GCCATTGCTACTTTAAAAAACGG + Intergenic
915369492 1:155336644-155336666 TATACTGTCTCTTTAAGAAAGGG + Exonic
915392653 1:155558550-155558572 AACACTGTCTCTTTAAAAAAAGG - Intronic
916699403 1:167275551-167275573 AACACTAACACTTTAAAAAGTGG - Intronic
916957753 1:169857221-169857243 GATACTGTCAGCTTACAAAAAGG - Intronic
917492312 1:175507982-175508004 GATACAGTCTTTTTAAAAAAGGG - Intronic
917822089 1:178773333-178773355 GACCCTGTCTCTTAAAAAAAAGG + Intronic
918023121 1:180714577-180714599 GACCCTGTCTCTACAAAAAATGG - Intronic
918299339 1:183188330-183188352 GACACGGTCACTTTGAGACATGG - Intronic
918650986 1:186962876-186962898 GACACTATTACTTTAGAAAGTGG - Intronic
920129433 1:203720387-203720409 GTCACTGTCACTCTAGAGAAAGG - Intronic
920227122 1:204447023-204447045 GGCCCTGTCACTTTCCAAAAAGG - Intronic
920357727 1:205387208-205387230 GACATTGTCATTTTCAAAAATGG + Intronic
920880176 1:209872474-209872496 GACACTGTCACCCTTTAAAATGG + Intergenic
921381019 1:214524641-214524663 GACCCTATCTCTTAAAAAAAAGG + Intronic
921646922 1:217630447-217630469 TACCCTCTCTCTTTAAAAAAGGG + Intronic
922211802 1:223492046-223492068 GCCACTGTCACTTTGTAGAATGG - Intergenic
922984040 1:229852123-229852145 GACCCTATCACTAAAAAAAAAGG - Intergenic
923234203 1:232016407-232016429 GATACAGTCCCTTTAATAAAAGG - Intronic
923259551 1:232255087-232255109 GACACTGAAAGTTTAAAAAATGG - Intergenic
923407553 1:233677887-233677909 GACAGTGTGACCTTAAAAACTGG + Intergenic
923640397 1:235753408-235753430 GACTCTGTCATTTTAAAAACAGG - Intronic
923706569 1:236349053-236349075 GACCCTGTCTCTAAAAAAAAAGG - Intronic
923735348 1:236601629-236601651 GACACTGTCTCTACAAAAAATGG + Intronic
924039480 1:239970554-239970576 GACACTGTCATTTAAAAACATGG - Intergenic
924777681 1:247121189-247121211 GACACTGTCTCAGAAAAAAAAGG + Intergenic
1064082116 10:12316730-12316752 GACAATGTCATTTTAAAAAATGG + Intergenic
1064114169 10:12563343-12563365 GACTCTGTCTCTAAAAAAAAAGG + Intronic
1064314652 10:14244157-14244179 AACACAATCACTTTAAGAAAAGG + Intronic
1065086487 10:22183797-22183819 GACTCTGTCTCTTAAAAAAAAGG - Intergenic
1065140082 10:22712489-22712511 GAAACTTACAATTTAAAAAAAGG - Intronic
1065270392 10:24026141-24026163 GAAACTGGCACTATATAAAAAGG - Intronic
1065593192 10:27286491-27286513 GAAAAACTCACTTTAAAAAAGGG + Intergenic
1065602226 10:27380704-27380726 GACACTGTCTCTGTATAAAGTGG + Intergenic
1066709074 10:38213795-38213817 GACCGTGTCACCTTAAAAAATGG + Intergenic
1066980429 10:42408698-42408720 GACACTGTCACTTTAAAAAATGG - Intergenic
1068588668 10:58830605-58830627 AACATTCTCACTTTAAAAAATGG + Exonic
1071316480 10:84405094-84405116 GACACTGTAACATTGACAAAGGG + Intronic
1071349501 10:84725669-84725691 GACACAGCCACTTTAGAAAATGG - Intergenic
1071827080 10:89336099-89336121 GACCCTGTCTCTGCAAAAAAAGG + Intronic
1072562456 10:96588315-96588337 TATACAGCCACTTTAAAAAAAGG + Intergenic
1072953932 10:99872480-99872502 GACACTGGCCCTTTAAAGGAAGG - Intergenic
1073857073 10:107689127-107689149 GAAACAGTCACTTTAATAAATGG + Intergenic
1074248780 10:111722705-111722727 TACACTGTCAATTTAAAAGGAGG - Intergenic
1074476298 10:113777751-113777773 GAAACTGAGGCTTTAAAAAATGG - Intronic
1074716160 10:116221433-116221455 GAGACTCTGTCTTTAAAAAAAGG - Intronic
1075488084 10:122843349-122843371 AACACTGTCATTTTACATAAGGG - Intronic
1076218570 10:128715461-128715483 AAAACTGTCACTTTAAAATATGG - Intergenic
1078381157 11:10842011-10842033 GATCCTGTCTCTTAAAAAAAAGG + Intronic
1080361844 11:31523919-31523941 TACACAGTCTCTTTAAATAAAGG + Intronic
1080693812 11:34583582-34583604 AACACTTGCATTTTAAAAAAAGG + Intergenic
1081215207 11:40388172-40388194 GACATTTTCCCTTTATAAAAAGG + Intronic
1081472643 11:43390312-43390334 GACCCTGTCTCTTAAAAAAAAGG + Intronic
1081729118 11:45356019-45356041 TTCACTGTCACTTCAATAAAGGG - Intergenic
1084343426 11:68525310-68525332 GACACTGCAACTTTATATAAAGG - Intronic
1084353649 11:68622647-68622669 TGAACTGTAACTTTAAAAAATGG + Intergenic
1084859264 11:72007494-72007516 GAAATGGTCACTTTCAAAAAGGG - Intronic
1086102007 11:83110578-83110600 GACCCTGTCTCTACAAAAAATGG - Intergenic
1086428250 11:86708327-86708349 GACCTTGTCCCTTAAAAAAAAGG + Intergenic
1087888601 11:103509950-103509972 GATACAGTGACATTAAAAAAGGG + Intergenic
1088087358 11:105997110-105997132 GACCCTGTCCCTTTAAAAAAAGG + Intronic
1088511075 11:110575473-110575495 GACTCTGTCTCAATAAAAAAAGG + Intergenic
1089439504 11:118503467-118503489 GACACTGACACCTCTAAAAATGG + Exonic
1089480489 11:118800815-118800837 GCCCCTGTCTCTTTAAAATAAGG - Intergenic
1089722316 11:120438317-120438339 GAAACTCCCTCTTTAAAAAAAGG - Intronic
1090130740 11:124139014-124139036 AAGACAGTCACTTTAATAAATGG - Intronic
1091033672 11:132214047-132214069 GACACTGTAACTGTGAACAAGGG + Intronic
1091426133 12:391089-391111 GACAATGTCACATTACAAAGGGG + Intronic
1091704463 12:2684354-2684376 AACACGGTCAATATAAAAAAGGG + Intronic
1091711035 12:2740704-2740726 AACACAGTCAATATAAAAAAGGG + Intergenic
1092437919 12:8467429-8467451 GACAATCTCTCTTTAACAAATGG - Intronic
1092841191 12:12542684-12542706 TAAACTGTCATTTTTAAAAAGGG + Intronic
1093322306 12:17727490-17727512 GAAACTGTGTCTTTAATAAATGG - Intergenic
1093607841 12:21114997-21115019 GACAAAGACACATTAAAAAAAGG - Intronic
1093817415 12:23566788-23566810 GTAACTGTCACTTTATAAAATGG + Intronic
1093884301 12:24441555-24441577 GCCACTGCCACTTTATAAAGGGG - Intergenic
1094252670 12:28382877-28382899 TACAGTTTCAGTTTAAAAAAAGG - Intronic
1095189403 12:39239005-39239027 CACACTGTCACTCAAACAAAGGG + Intergenic
1095328071 12:40922434-40922456 TAAACTGTAACTTTTAAAAAAGG + Intronic
1095503814 12:42870600-42870622 GGTACAATCACTTTAAAAAATGG - Intergenic
1095791808 12:46175881-46175903 GACTCTGCCTCTTAAAAAAAAGG - Intergenic
1096703570 12:53403864-53403886 GACCCGGTCTCCTTAAAAAAAGG + Intronic
1097834620 12:64260548-64260570 ACCACCGTCCCTTTAAAAAATGG + Intergenic
1097877999 12:64661472-64661494 GACCCTGTCTCTAAAAAAAAGGG + Intronic
1098257155 12:68628094-68628116 GACCCTGTCTCTTAAAAAGAAGG + Intronic
1098467068 12:70799772-70799794 GATGCTGTAAATTTAAAAAACGG - Intronic
1100026054 12:90129619-90129641 AACACTGTCAATATAAAATAAGG - Intergenic
1100727726 12:97426812-97426834 GATACTGTTACTATACAAAAAGG - Intergenic
1100931165 12:99610970-99610992 AACACTGTCACTGCCAAAAAAGG + Intronic
1101072674 12:101092721-101092743 AACATTGTAATTTTAAAAAAAGG - Intronic
1101533010 12:105591731-105591753 GCAACAGTCACTGTAAAAAATGG - Intergenic
1101959989 12:109241837-109241859 GGCAATATCTCTTTAAAAAATGG - Intronic
1102754221 12:115323761-115323783 TACACTGTGACTTTCAAAATGGG - Intergenic
1103545443 12:121697945-121697967 AACCCTGTCACTATCAAAAAAGG + Intergenic
1105411605 13:20176104-20176126 CACACTATCAATTTGAAAAAGGG + Intergenic
1105421500 13:20256295-20256317 GACATGATCACTTAAAAAAATGG - Intergenic
1105784214 13:23732350-23732372 GATACAATCACTTTGAAAAAAGG + Intronic
1105998407 13:25694855-25694877 GACTCTGTCCCTAGAAAAAAAGG - Intronic
1106033832 13:26026244-26026266 GACATTGTTACTTTAAAAAGAGG + Intergenic
1107455923 13:40554474-40554496 GAGACTGCCACTTTTAAACATGG + Intergenic
1107734966 13:43389577-43389599 GATAATGTCATTTTTAAAAAAGG - Intronic
1108930329 13:55809892-55809914 GAAAATGTTACTTGAAAAAAGGG + Intergenic
1109112044 13:58333433-58333455 AAAACAGTTACTTTAAAAAAAGG - Intergenic
1110221237 13:73076207-73076229 AACACTGTCACATTAAATGATGG - Exonic
1110229011 13:73149111-73149133 GACACTTTTGATTTAAAAAATGG + Intergenic
1110512660 13:76369710-76369732 GACAGTGTCACAATAAATAAAGG - Intergenic
1110679840 13:78296454-78296476 GCCACTGTCATTTAAAAAAAGGG - Intergenic
1111196737 13:84884625-84884647 GACACAGGAACTTTAACAAATGG + Intergenic
1111369286 13:87295372-87295394 GATAATATCACTTTAAAATATGG + Intergenic
1116020097 14:39449951-39449973 TAAACTCTCACTTTATAAAAAGG - Intergenic
1116547810 14:46192281-46192303 AAGACAGTCACTTTAATAAATGG - Intergenic
1116843223 14:49840632-49840654 GACCCTGTCTCTTAAAAAAAAGG - Intronic
1116897088 14:50327039-50327061 GACCCTGTCTCTTAAAAAAAAGG + Exonic
1117001894 14:51378511-51378533 GACCCTATCTCTTAAAAAAAAGG + Intergenic
1117007653 14:51438065-51438087 GACAAAAACACTTTAAAAAATGG + Intergenic
1117762375 14:59043505-59043527 GAAAATATCATTTTAAAAAAAGG - Intergenic
1118173425 14:63412262-63412284 GACCCTGTTTGTTTAAAAAAGGG + Intronic
1118628871 14:67684920-67684942 GACAATGTACTTTTAAAAAAGGG + Intronic
1120210785 14:81631675-81631697 TAGACTTTCAATTTAAAAAAAGG - Intergenic
1120383679 14:83816650-83816672 GACACTGTAACTTTATGTAAAGG - Intergenic
1121675115 14:95746143-95746165 AACTCTCTTACTTTAAAAAAGGG + Intergenic
1122290010 14:100675550-100675572 GACCCTGTCACTTTCAAAGTGGG + Intergenic
1122563589 14:102635006-102635028 GACTCCATCTCTTTAAAAAAAGG - Intronic
1123712884 15:23002989-23003011 GACCCTGTCTCTAAAAAAAAGGG + Intronic
1124554742 15:30714191-30714213 AACACAGTCTCTTTAATAAATGG - Intronic
1124676505 15:31691489-31691511 AACACAGTCTCTTTAATAAATGG + Intronic
1124895404 15:33771843-33771865 GACACTGCCAGTTTCAAGAAGGG + Intronic
1125761048 15:42095767-42095789 TACACTGTCTCTTTAAAAAAAGG + Intergenic
1126037923 15:44564910-44564932 GACCCTGTCTTTTTTAAAAAAGG - Intronic
1126146929 15:45483380-45483402 GAAACTGTCACTGTTGAAAAGGG + Exonic
1126166412 15:45657827-45657849 GACACTTGCATTTTAATAAAGGG + Intronic
1126917166 15:53478480-53478502 GACACTGTCATTTTTGACAAGGG + Intergenic
1127579471 15:60324270-60324292 GAAACTTTCATTTTTAAAAAAGG + Intergenic
1127609371 15:60622036-60622058 GAAACTGTGACTCAAAAAAAAGG + Intronic
1127998750 15:64171636-64171658 GACACCTTCACTGTAAACAATGG + Exonic
1128006963 15:64252041-64252063 GATCCTGTCACTTTAAAGAGAGG + Intronic
1129083916 15:73068231-73068253 GACACTGTCTCAAAAAAAAAGGG - Intronic
1131281773 15:91027293-91027315 GACCCTGTCTCTATAAAAATAGG - Intergenic
1133151355 16:3834461-3834483 GTGACTGTAACTTTACAAAAAGG + Intronic
1133747796 16:8700604-8700626 GTCAATGTCTCTTTAAAAAAGGG - Intronic
1133753750 16:8745807-8745829 GACACTGTAGATTTTAAAAAAGG - Intronic
1137306915 16:47210370-47210392 CACACTGTCAAATTAAAACATGG - Intronic
1137585605 16:49662446-49662468 TGCAATGTCATTTTAAAAAATGG - Intronic
1139348757 16:66322194-66322216 GACCCTGTGTCTTTAAAAAAAGG - Intergenic
1139458164 16:67100224-67100246 GACACAGTCAATTCAGAAAATGG + Exonic
1140200841 16:72893530-72893552 GGTACTCACACTTTAAAAAATGG + Intronic
1140592194 16:76367076-76367098 GATACTGGCACATTAAAATATGG + Intronic
1140746180 16:77982461-77982483 TGCACTGTCACATTTAAAAATGG + Intergenic
1142320327 16:89378177-89378199 GACTCTGTCTCTTTAAGAAGCGG + Intronic
1142575947 17:907772-907794 GACACTGCAACTTTCATAAATGG + Intronic
1143079868 17:4373469-4373491 GACCCCGTCTCTTAAAAAAATGG + Intergenic
1143842089 17:9740680-9740702 GACACTGGGACTTCAAAAGAGGG + Intergenic
1144162570 17:12575840-12575862 CAAAATGTTACTTTAAAAAAGGG - Intergenic
1144799486 17:17915514-17915536 GATCCTGTCTCTTAAAAAAAAGG - Intronic
1144913007 17:18698475-18698497 CACACTGTCAGTCTATAAAACGG - Exonic
1145284950 17:21498387-21498409 GACACTGTAACTCTAGAGAAAGG - Intergenic
1145733391 17:27211017-27211039 GAGGCTGTCTCTTCAAAAAAGGG - Intergenic
1146866573 17:36340469-36340491 TCCAATGTGACTTTAAAAAAAGG - Intronic
1146979905 17:37150742-37150764 GACTCTGTCTCTTAAAAAAAAGG + Intronic
1147069442 17:37941073-37941095 TCCAATGTGACTTTAAAAAAAGG - Intergenic
1147080971 17:38020613-38020635 TCCAATGTGACTTTAAAAAAAGG - Intronic
1147096913 17:38144570-38144592 TCCAATGTGACTTTAAAAAAAGG - Intergenic
1147158166 17:38555568-38555590 GACTCTGGCATTTTAAAAAAAGG + Intronic
1147950835 17:44106956-44106978 GACCCTATCTCTTAAAAAAAGGG - Intronic
1148227715 17:45910510-45910532 GGCACTGGCAGTTTAATAAAGGG - Intronic
1148287748 17:46410731-46410753 GATTCTGTCTCTTAAAAAAAAGG + Intergenic
1148309917 17:46628311-46628333 GATTCTGTCTCTTAAAAAAAAGG + Intronic
1148378276 17:47170205-47170227 GACCCTATCTCTTTAAAGAAAGG - Intronic
1149266992 17:54937732-54937754 GAGAGTCTCACTTTATAAAATGG + Intronic
1150515083 17:65799837-65799859 CACACTGTCACATTCACAAATGG + Intronic
1151153197 17:72105473-72105495 GACTCTGTCTCTTAAAAAAATGG + Intergenic
1151704906 17:75762306-75762328 GACCCTGCCTCTTAAAAAAAAGG + Intronic
1152150226 17:78594946-78594968 GACTCTGTCTCTTAAAAAAAAGG - Intergenic
1153042255 18:824298-824320 GACCCTGTCTCTACAAAAAATGG + Intergenic
1153196767 18:2608212-2608234 GACACTGTCTCAAAAAAAAAAGG - Intronic
1153235385 18:2981146-2981168 GAAACTGTCACCTTACAAAAGGG + Intronic
1153571627 18:6478884-6478906 GAAACTGTAATTTTAGAAAAGGG - Intergenic
1153859958 18:9192708-9192730 GACCCTGTCTCTAAAAAAAAAGG - Intronic
1154104299 18:11506722-11506744 GACATTGTAATTTTAAAAATGGG - Intergenic
1154111810 18:11576139-11576161 GCTGCTGTCACTTTAAAAAATGG - Intergenic
1154237651 18:12621043-12621065 GACCATGTCTCTTAAAAAAAGGG + Intronic
1154245538 18:12693839-12693861 GACCCTGTCTCTTAAATAAATGG - Intronic
1154292397 18:13121098-13121120 GACACTGTGACTTTAGACAAAGG + Intronic
1155346038 18:24857886-24857908 GAAACTGTCACGGAAAAAAAGGG + Intergenic
1156065170 18:33133499-33133521 GACAGTTTCAATTTAGAAAAAGG - Intronic
1156985260 18:43343284-43343306 GACACCTCCACTTTAAAAAGTGG - Intergenic
1157527988 18:48399705-48399727 GACAATCTCATTTTAAAAAGAGG + Intronic
1157644232 18:49250909-49250931 GACTATGTCACTTTAAGAAAGGG + Intronic
1158369998 18:56789909-56789931 GACACATTCATTTTAAAAAATGG + Intronic
1158525399 18:58208708-58208730 GACAAGGTCACTTTTTAAAAGGG + Intronic
1159270222 18:66139615-66139637 GATTTTGTCATTTTAAAAAAGGG + Intergenic
1159801986 18:72912311-72912333 GAAACTGTCACATTCTAAAATGG - Intergenic
1160522072 18:79513480-79513502 CAAAATGTCACTTTAAAAACTGG + Intronic
1161462529 19:4406914-4406936 GACTCTGTCTCTTGAAAAAAAGG + Intronic
1162242507 19:9366286-9366308 GACCTTGTCTCATTAAAAAAAGG - Intronic
1162469903 19:10866504-10866526 GAAACTGTATCTTAAAAAAAAGG - Intronic
1162498821 19:11039343-11039365 GACCCTGTCTCTGAAAAAAAGGG + Intronic
1162834324 19:13306383-13306405 GGCCCTGTCTCTTAAAAAAAAGG - Intronic
1162891529 19:13736725-13736747 GACCCTGTCTCTTAAAAAAATGG - Intronic
1163106684 19:15127248-15127270 GACCCTGTCTCTAAAAAAAAGGG + Intergenic
1163431814 19:17272706-17272728 GACCCTGTCTCTTTAAAAAAAGG + Intronic
1166808937 19:45504042-45504064 GACCTTGTCTCTTAAAAAAACGG - Intergenic
1166898991 19:46043879-46043901 AACATTGTCCATTTAAAAAATGG + Intronic
1167221085 19:48198593-48198615 GACACTGTCTCTAACAAAAAAGG - Intronic
1167830664 19:52019025-52019047 GACCCTGTCACTACAAAAATTGG - Intronic
1168550362 19:57288209-57288231 GACCCTGTCTCTTAAAAAAGGGG - Intronic
925079889 2:1055766-1055788 GGCACGGTCACCTTAGAAAATGG - Intronic
925240081 2:2317414-2317436 GACTCCCTCACTTTAAACAAGGG + Intronic
925666066 2:6257719-6257741 AACACTGGCACTTTCAGAAAAGG + Intergenic
926252226 2:11161525-11161547 GACCCTGTCTCTTAAAAAAAAGG - Intronic
926568150 2:14500713-14500735 GTCCCTGTCTCTTAAAAAAAGGG + Intergenic
927994638 2:27475039-27475061 GACACTCTGATTTTAAAAATGGG + Intronic
928498942 2:31866495-31866517 GAAAATGTGACTTTTAAAAATGG - Exonic
929354682 2:41006299-41006321 GAAACTGTCTTTCTAAAAAAGGG - Intergenic
930133992 2:47882569-47882591 GACACAGGGATTTTAAAAAATGG - Intronic
930558173 2:52926604-52926626 GACATTCTAATTTTAAAAAATGG - Intergenic
930874214 2:56195150-56195172 AACACTTTCTCTTTACAAAAGGG + Intronic
930940179 2:57002988-57003010 CACACAGGCACTTTAAATAATGG - Intergenic
931308010 2:61051048-61051070 GATACTGTCGTTTCAAAAAAGGG - Exonic
931507467 2:62946116-62946138 GAAACATCCACTTTAAAAAATGG - Intronic
932328620 2:70882807-70882829 GACTCTGTCTCTACAAAAAATGG + Intergenic
934934502 2:98454843-98454865 GACACTGTTTTTTTAAAGAATGG + Intronic
935359903 2:102238325-102238347 GACCCAGTCACATTAAATAAAGG + Intronic
935560706 2:104556706-104556728 GACAGTGCCACCTAAAAAAACGG + Intergenic
938047434 2:128134566-128134588 AACTCTCTCACCTTAAAAAATGG - Intronic
939551583 2:143622416-143622438 TTTACTGTCACTTTAAAGAACGG - Intronic
940956656 2:159736116-159736138 GACCCTGTCTCTTAAAATAAGGG + Intronic
941833771 2:169993474-169993496 GACTCTGAAACTTTAAAAAGGGG - Intronic
941950326 2:171149194-171149216 GACCCTGTCTCTAAAAAAAAGGG + Intronic
942945312 2:181665865-181665887 GAAACAGTCACATTAAAAAAGGG + Intronic
943392439 2:187286268-187286290 GACACTGTAAGGTTAAGAAAGGG - Intergenic
944549320 2:200830897-200830919 GACCTTGTCTCTTAAAAAAAAGG + Intergenic
945571365 2:211471965-211471987 GACCCTGTCTCTTAAAAAAGGGG + Intronic
945940203 2:215941683-215941705 GACACAGCCACCTTAATAAAAGG - Intergenic
945942792 2:215966490-215966512 CACACTGACACTTTAATAAAAGG + Intronic
946438207 2:219673275-219673297 GACACTGTCTCAAAAAAAAAAGG - Intergenic
946700518 2:222408260-222408282 CACACTGTCATCTTAAAAAATGG - Intergenic
946810234 2:223515657-223515679 GACCCTGTCTCTACAAAAAAAGG + Intergenic
947332912 2:229048811-229048833 AATACTGTTACTTTAAAAACTGG - Intronic
947388719 2:229618293-229618315 GACACTGTCAGTCTAGAAAGGGG + Intronic
947560829 2:231149743-231149765 CACACTGTCATTTTAAGATAGGG + Intronic
947850024 2:233279167-233279189 GACCCTGTGTCTTTTAAAAAAGG + Intronic
948052750 2:234990975-234990997 GACCCAGTGACTTTATAAAAGGG - Intronic
948343179 2:237271354-237271376 TAAACTGTAATTTTAAAAAAGGG - Intergenic
948747043 2:240104380-240104402 GCCACTGGCACTTCAAAACATGG - Intergenic
949038533 2:241833178-241833200 GACCCTGTGTCTTAAAAAAAAGG + Intergenic
949042669 2:241856646-241856668 GACCCTGTCTCTAAAAAAAATGG + Intronic
1168731503 20:86078-86100 AAAACAGTCTCTTTAAAAAATGG - Intergenic
1169313855 20:4571622-4571644 GACCATGGCACATTAAAAAAGGG + Intergenic
1169619276 20:7487025-7487047 TATACTTTCACTTTAAAACAAGG + Intergenic
1170867126 20:20168088-20168110 GACCCTATCTCTTTAAAAAAAGG - Intronic
1170943557 20:20869421-20869443 GATGCTTTCACTTGAAAAAATGG - Intergenic
1171441275 20:25165444-25165466 GAGACTGTGACATTAAAATAGGG - Intergenic
1171818949 20:29815015-29815037 GACAAAGACACATTAAAAAAAGG - Intergenic
1172823004 20:37755210-37755232 GATGCTGTGACTTTTAAAAATGG + Intronic
1173127692 20:40355055-40355077 CACACTGTCACTGTACAAACAGG - Intergenic
1173838902 20:46144085-46144107 GACCCTGTCTCAATAAAAAAAGG + Intergenic
1174219886 20:48945853-48945875 GACCCTGTCTCTTTAAAAAAAGG + Intronic
1174765281 20:53247868-53247890 AACACTGACAGTTTTAAAAATGG - Intronic
1174892859 20:54416351-54416373 GACAGTGTCATTTGAAGAAATGG - Intergenic
1176013626 20:62915170-62915192 GTCACTGTCCCTTTAAAAGGAGG - Intronic
1176154582 20:63612103-63612125 GACTCTGTCAAGGTAAAAAATGG + Intronic
1177251845 21:18602877-18602899 GACTCTGTCTCTTAAAAAAAAGG - Intergenic
1177459162 21:21387641-21387663 GTCTCTTTCACTTTACAAAATGG - Intronic
1177682145 21:24385582-24385604 AACAATGTCACTTTATAACAAGG - Intergenic
1178031303 21:28529439-28529461 TACACTCTCACTTTAAATAAAGG - Intergenic
1178625754 21:34217115-34217137 GACATTTTCACTGTTAAAAAAGG + Intergenic
1180244172 21:46535543-46535565 GACCCTGTCTCTACAAAAAAAGG + Intronic
1180322926 22:11339712-11339734 GACAAAGACACATTAAAAAAAGG - Intergenic
1180734909 22:18008913-18008935 GAGGCTGTCTCTTCAAAAAAGGG + Intronic
1181271866 22:21663741-21663763 GATCCTGTCTCTTTAAAAAAGGG - Intronic
1181545983 22:23602671-23602693 GAGACTGTGTCTCTAAAAAAGGG + Intergenic
1181762180 22:25066321-25066343 GACCCTGTGTCTATAAAAAATGG - Intronic
1181954241 22:26576794-26576816 GACCCTGTCTCTAAAAAAAAAGG + Intronic
1182079706 22:27520254-27520276 GACCCTGTCTCTATAAAAAGTGG + Intergenic
1182566964 22:31207274-31207296 GAGACTGTCTCTTAAAAAAAAGG + Intergenic
1183088991 22:35508484-35508506 GACCCTGTCTCTTAAAACAAAGG - Intergenic
1183926116 22:41207395-41207417 AACCCTGTCTCTATAAAAAATGG - Intronic
949394898 3:3604082-3604104 AGCACTGTGACTTTAAATAATGG + Intergenic
950801658 3:15556723-15556745 GACCCAGTCACTTGAGAAAAGGG + Intergenic
950834077 3:15902742-15902764 GACCCTGTCTCTTCAAAAAAAGG - Intergenic
950960748 3:17104071-17104093 AACACTGTCTCTTTAATAAATGG + Intergenic
951014542 3:17715791-17715813 GACTATGTCTCTTAAAAAAAAGG + Intronic
951862880 3:27273413-27273435 GACACTGTCAATCTACAAACAGG + Intronic
951948494 3:28170592-28170614 GACCCTGTCTCTATAAAAAAAGG + Intergenic
952326082 3:32321771-32321793 GACTCTGTCTCTACAAAAAATGG - Intronic
952409621 3:33035421-33035443 GACACTGTCTCAAAAAAAAAAGG + Intronic
952581470 3:34838395-34838417 CAAACTGTCACTTAAAACAACGG + Intergenic
953298715 3:41750166-41750188 GAAACTGTCAGTTTAATAAACGG + Intronic
953739515 3:45525183-45525205 GACACTTATACTGTAAAAAAGGG - Intronic
953819240 3:46190025-46190047 AACATTGTCAAATTAAAAAAAGG - Intronic
955479295 3:59373219-59373241 GGTACTGTCACTTTGAAAGATGG + Intergenic
955714899 3:61819051-61819073 GACTCTGTCACTATAAGGAAAGG + Intronic
955782706 3:62502879-62502901 GACAAAGTGACTTTAACAAAGGG + Intronic
956399704 3:68864263-68864285 AACAATGTGACTTTAAAAAGTGG + Intronic
956476720 3:69629586-69629608 GTCAATGTCATTTTAAAAACGGG + Intergenic
956611960 3:71133351-71133373 GACAATTTCTCTTTTAAAAATGG - Intronic
956692473 3:71890875-71890897 GAAACTCACACTTTAAAAATGGG + Intergenic
957582107 3:82087371-82087393 GATAATGTGATTTTAAAAAAAGG - Intergenic
957808204 3:85180200-85180222 GATACTTTCAGGTTAAAAAAGGG + Intronic
957851180 3:85809564-85809586 GACCCTGTCTCATAAAAAAAGGG + Intronic
957940176 3:86993207-86993229 CACACTGACACTATAAAAATTGG + Intergenic
958511327 3:95053214-95053236 GAAACTGATACTTTAAAATATGG + Intergenic
958900585 3:99881486-99881508 GACAAGGTCCCTTTAAAAAATGG - Intronic
961782481 3:129328725-129328747 GAAAATGAAACTTTAAAAAAAGG + Intergenic
962863831 3:139429899-139429921 GACCCTGCCACTTTTAAATAAGG + Intergenic
963345500 3:144091904-144091926 GACAAAGGCAGTTTAAAAAAGGG + Intergenic
963897342 3:150701363-150701385 GAAAATGTCATTTTAAATAATGG + Intronic
964053850 3:152427395-152427417 GACCCTCTATCTTTAAAAAAAGG - Intronic
964363340 3:155921781-155921803 GACTCTATCTCTTAAAAAAAGGG + Intronic
964524612 3:157605351-157605373 GACACTGTCTCAAAAAAAAAAGG - Intronic
965503624 3:169485580-169485602 AACATTTTCACTTTAAAAAGAGG + Intronic
966205411 3:177400960-177400982 GGCACTGACACTCAAAAAAAGGG + Intergenic
967820435 3:193834581-193834603 GAGACGGTCACCTTAAAAAGAGG + Intergenic
967953833 3:194861807-194861829 AACAGTGGCAGTTTAAAAAATGG - Intergenic
970219137 4:13791055-13791077 GTCAATTTCACTTTGAAAAATGG + Intergenic
970507507 4:16746473-16746495 GAAACTGCAACTTTAAAAATGGG + Intronic
971284942 4:25280007-25280029 GGCACCGTCATTTTTAAAAAAGG - Intergenic
971783567 4:31071091-31071113 GACACTGTCAAGTTGATAAATGG + Intronic
972213879 4:36872868-36872890 GATTCTGTTACTTTAAAAAGAGG + Intergenic
973255597 4:48109199-48109221 GACCCTATCTCTATAAAAAAAGG - Intronic
973543277 4:51955575-51955597 GACACCGTCCTTTTAAAAATAGG - Intergenic
974073605 4:57148185-57148207 GACTCTGTCTCTAGAAAAAAAGG + Intergenic
974074157 4:57153720-57153742 AACACAGTCCCTTTAAAAGAAGG + Intergenic
974252830 4:59410874-59410896 GAAACTGTTACTTTTAAAAGAGG + Intergenic
974255260 4:59444916-59444938 CACACTGGCAGTTTGAAAAACGG + Intergenic
974504658 4:62753339-62753361 GACATTGCCATTTTAAAAACAGG + Intergenic
975978808 4:80131470-80131492 GACACTGTCAGTAAAGAAAAAGG - Intergenic
976250951 4:83051414-83051436 GACCCTGTCTTTTTTAAAAAAGG + Intronic
976346306 4:84005801-84005823 GACACTGTTACTAAATAAAATGG - Intergenic
976764051 4:88580506-88580528 GACTGTCTCAATTTAAAAAAAGG + Intronic
977036050 4:91954864-91954886 GACCCTGTCTCTTTAAAAAAAGG - Intergenic
977520707 4:98080265-98080287 GACCCTGTCTCTAAAAAAAAAGG - Intronic
977563821 4:98561556-98561578 GACAGCGACACTTTAAAGAATGG + Intronic
977912929 4:102558657-102558679 GACCCTGTCTCTTAAAAAAATGG - Intronic
978500977 4:109409721-109409743 GAATCTGTCACTTTAAAACATGG + Intergenic
979674874 4:123399066-123399088 GGCACTGCCACTTTAAAAGTGGG + Intronic
980948771 4:139350266-139350288 GACACTGCCTCTTAAATAAAAGG + Intronic
982349319 4:154397715-154397737 TACAAGTTCACTTTAAAAAATGG + Intronic
984875746 4:184365986-184366008 GACACAGTCACTGTAAAATTGGG + Intergenic
984878968 4:184393744-184393766 GACACTGACAGTTTCAAAAAGGG + Intronic
984908482 4:184650403-184650425 GACTCTGTGACTATAAAAGATGG - Intronic
986014225 5:3743711-3743733 GACACTGTCACCATAAAGAGGGG + Intergenic
986910878 5:12554878-12554900 TACACTGTCACTTTTTAGAATGG + Intergenic
987681988 5:21147745-21147767 AAGACTGTCTCTTTAATAAATGG - Intergenic
990770626 5:59240226-59240248 GTCACTGTCACATAAAATAATGG - Intronic
991059740 5:62360728-62360750 GACACTCTCAATTTAGGAAAAGG - Intronic
992143569 5:73822637-73822659 GACTCTGTCTCTAAAAAAAATGG - Intronic
992808708 5:80364075-80364097 GACCCTGTTGCTTAAAAAAAAGG - Intergenic
993686203 5:90941381-90941403 GTCATTCTCATTTTAAAAAATGG - Intronic
994426631 5:99596896-99596918 GGCACTGTCTCTTCAAAAATAGG + Intergenic
995746138 5:115406156-115406178 GAGACAGTCTCTTCAAAAAATGG - Intergenic
995840868 5:116442028-116442050 GACCCTTTCATTTTAAAAATGGG - Intergenic
995993071 5:118265798-118265820 GATTCTGTCACTTTAGAAATAGG + Intergenic
996259662 5:121450436-121450458 GACAGAGACACATTAAAAAAAGG + Intergenic
996888723 5:128390798-128390820 GAGCCTGTCACTTTAAGAAAAGG + Intronic
996889279 5:128398625-128398647 GACACTGAAACGTTAAAAAGAGG + Intronic
997184482 5:131867946-131867968 GATACAGTCACTTTGGAAAATGG - Intronic
997739151 5:136238533-136238555 GCCACTGTCACTTAGAGAAATGG + Intronic
998087257 5:139336562-139336584 GACGCTGTCTCTAAAAAAAAAGG - Intergenic
998187455 5:139992521-139992543 GAAGCAGTCACTTTAAAACAAGG - Intronic
999166762 5:149555987-149556009 AACACTGTGGCTTAAAAAAATGG - Intronic
1000133395 5:158321267-158321289 GACACTGTCAGTTTCCAAAGTGG - Intergenic
1000232564 5:159329754-159329776 AACAATGTCATTTTAACAAAGGG - Intronic
1000326265 5:160174942-160174964 GACCCTGTCTCTATAAAAAATGG - Intergenic
1000686706 5:164258830-164258852 TCCAGTGTCAATTTAAAAAATGG - Intergenic
1001206710 5:169770027-169770049 GCCAGTGTCCCTTTAAGAAAAGG + Intronic
1001215729 5:169854135-169854157 GACACTATTTCTTTAAAAATAGG + Intronic
1003088169 6:3078070-3078092 GACCTTGTCTCTATAAAAAAAGG - Intronic
1003101688 6:3180712-3180734 GACCCTGTCTCTTAAAAAAATGG + Intergenic
1004821308 6:19371003-19371025 GACATACTGACTTTAAAAAAAGG - Intergenic
1005466390 6:26119537-26119559 GATAATGTCATTTTTAAAAATGG - Intronic
1005484507 6:26286641-26286663 AAAACTGTAACTTAAAAAAAAGG - Intergenic
1006889840 6:37417116-37417138 GACACCATCTCTTTAAAAATAGG + Intergenic
1007980336 6:46148692-46148714 GACAGAGTCACTAAAAAAAAAGG - Intergenic
1008088913 6:47273576-47273598 GAAACTTTCCCTTTGAAAAATGG + Intronic
1008093926 6:47319461-47319483 AAGACTGTCCCTTTCAAAAAGGG - Intergenic
1008359046 6:50593153-50593175 GACCCTGTCTCTATAAAAAAAGG - Intergenic
1010902936 6:81450193-81450215 TACACTTACCCTTTAAAAAAAGG + Intergenic
1011217661 6:85022084-85022106 GACACTGTACCATTAAAAATAGG - Intergenic
1011469421 6:87692902-87692924 TACACTGAAACTTCAAAAAATGG + Intronic
1011754657 6:90486431-90486453 GACTCTGTCTCTTCAAAAAAAGG + Intergenic
1012025002 6:93978193-93978215 GAGACTGTCACATTACAACAGGG + Intergenic
1012467117 6:99528369-99528391 GACATTGACACTTTTAAAAAGGG + Intergenic
1012844196 6:104368812-104368834 GACCCTGTCACTACAAAACAAGG + Intergenic
1015246129 6:131076781-131076803 CACCCTGTCTCTTAAAAAAAAGG - Intergenic
1016227936 6:141763347-141763369 TACACTATCACATTAAGAAAGGG + Intergenic
1016326870 6:142912842-142912864 GAGACTGTGAGTTTAAAGAATGG + Intronic
1016452362 6:144196196-144196218 GTCAGTGCCACATTAAAAAATGG + Intergenic
1016461459 6:144284116-144284138 GAAACTTTCACTATAACAAAAGG + Intergenic
1016557639 6:145357229-145357251 GAAACAGTCACTTTAAAAAAAGG + Intergenic
1017527642 6:155255999-155256021 GACACTGTCTTTAAAAAAAAAGG + Intronic
1017864723 6:158433145-158433167 GAAAAAGTCAATTTAAAAAACGG - Intronic
1018147082 6:160901457-160901479 GACAATGTTAATTTGAAAAATGG - Intergenic
1018173109 6:161157228-161157250 AACAATGTCACTTTTAAGAAGGG + Intronic
1018516642 6:164587181-164587203 GAAAATGTCACATGAAAAAATGG - Intergenic
1018951707 6:168382607-168382629 GACTCTGTGACATTAAACAAGGG - Intergenic
1021059925 7:16099242-16099264 GACCCTATCTCTTTAAAAAGAGG + Intronic
1021212051 7:17865891-17865913 AAAACAGTCACTTTAATAAATGG + Intronic
1021595083 7:22306793-22306815 GACACAGTCTCTTTAATAAATGG - Intronic
1023267433 7:38422098-38422120 GACAATTTCACTTTAAATACTGG + Intronic
1024368107 7:48546667-48546689 GATACGGTCACTTAAAAAACGGG - Intronic
1024631521 7:51252174-51252196 GACACTGGCTTTTTAAAAACAGG + Intronic
1025029337 7:55544151-55544173 GACATTGTCTCTTCAATAAATGG - Intronic
1026377371 7:69765489-69765511 GACCCTGACTCTTTAACAAAAGG - Intronic
1026566097 7:71490883-71490905 GACCCTGTCTCTTTAAAAAAAGG + Intronic
1026640038 7:72116347-72116369 GTCCCTGTCTTTTTAAAAAAAGG + Intronic
1028386905 7:90265305-90265327 GACACTTTCTTTTTCAAAAATGG - Exonic
1029422937 7:100480648-100480670 GACCCTGTCTCTAAAAAAAAAGG - Intergenic
1029488905 7:100859700-100859722 GACCTTGTCTCTTAAAAAAAAGG + Intronic
1029646609 7:101860813-101860835 GACTCTGTCTCTTTAAAAAAAGG - Intronic
1031820447 7:126494260-126494282 GATATTGCAACTTTAAAAAATGG - Intronic
1032601918 7:133306521-133306543 GACTCTGTCTCTACAAAAAAAGG + Intronic
1033080033 7:138287552-138287574 GACCCTGTCTCTTCTAAAAATGG - Intergenic
1033335597 7:140449587-140449609 GACTCTGCCACTTTAACACATGG + Intergenic
1034035398 7:147815121-147815143 TACACTATCACTTCATAAAAGGG - Intronic
1034365359 7:150541553-150541575 AAAATTGTCACATTAAAAAATGG - Intergenic
1036474636 8:9082010-9082032 GACACAGTGACTTTAAAAGTTGG - Intronic
1036573668 8:10004142-10004164 GCAACTGACACTTTAAAAATGGG - Intergenic
1036924350 8:12889909-12889931 GACAATCTAACTTTCAAAAATGG + Intergenic
1037318008 8:17617157-17617179 AACACTTTCACTTTGAAACATGG + Intronic
1038112377 8:24513764-24513786 GATGCTGTCACTTTTAAAACTGG - Intronic
1038468964 8:27794815-27794837 GACACAGTCTCTTCAATAAATGG - Intronic
1038897872 8:31806708-31806730 GTCTCTGACACTTAAAAAAAGGG - Intronic
1040506650 8:48055109-48055131 AACACTTTCACTTTAAAGAGTGG - Intronic
1041247091 8:55898836-55898858 GAAACTGTCTATTTAAAAAAAGG - Intronic
1041763913 8:61397113-61397135 GGCACAGTCACTTTGGAAAATGG - Intronic
1042558571 8:70054826-70054848 GACACTGTCTCAAAAAAAAAAGG - Intronic
1042569913 8:70152467-70152489 GACACTATCAGTTTAAAATATGG + Intronic
1042893831 8:73643576-73643598 GACAATATCAATTTAAAAACAGG + Intronic
1043150647 8:76711250-76711272 GAGACTCTCACTTGAAGAAATGG - Intronic
1044217002 8:89624146-89624168 GAAAATGTCACTTAAAAAAAAGG + Intergenic
1045527220 8:102951306-102951328 GACACTGTCTCAAAAAAAAAAGG + Intronic
1046761094 8:118021837-118021859 GATAATTTCACTTTAAATAAAGG - Intronic
1047349135 8:124056621-124056643 GACACTTTACCTTTAAAACAGGG - Intronic
1047992816 8:130304360-130304382 GACACATTCACCCTAAAAAAAGG + Intronic
1048089874 8:131228056-131228078 GAAAATGTGATTTTAAAAAATGG - Intergenic
1048761624 8:137801788-137801810 GTCACTCTCATTTTAAAAAAAGG - Intergenic
1048925590 8:139268066-139268088 GACAGGGTCAATATAAAAAAGGG + Intergenic
1049142114 8:140964233-140964255 GACCCTGTCTCTTAAAAAACAGG - Intronic
1050676869 9:8065552-8065574 GACACTTTCACTTTATAATGGGG - Intergenic
1050845062 9:10205818-10205840 GATACTATAACTTTAAAAATAGG + Intronic
1052758075 9:32561973-32561995 GTCACTCTCCCATTAAAAAATGG + Intronic
1056254156 9:84781216-84781238 GAAACTGGCATTTTGAAAAAGGG + Intronic
1056371198 9:85955952-85955974 GACACTGTTACTGGAACAAAAGG + Intronic
1056603992 9:88070048-88070070 GACACTGGCACTTTAGCACAAGG - Intergenic
1057645557 9:96871699-96871721 GACCCTGTCACTCTAAAAAATGG + Intronic
1059230193 9:112713679-112713701 GACCCTGTCTCTTAAAAAAAAGG + Intronic
1060935805 9:127515210-127515232 GACTCTGTCTCTTAAAAAACAGG + Intronic
1203370614 Un_KI270442v1:300282-300304 GACAAAGACACATTAAAAAAAGG - Intergenic
1185766759 X:2732019-2732041 GACTCTGTCTCTACAAAAAAAGG - Intronic
1187861492 X:23687848-23687870 GACCCTGACTCTTAAAAAAAGGG - Intergenic
1188697406 X:33212548-33212570 GAGTCTGTCACTTTAACAAATGG - Intronic
1189562827 X:42208593-42208615 GAAACTGTCCCTTTAAAATAAGG + Intergenic
1189791730 X:44611429-44611451 GACCCTGTCTCTACAAAAAATGG + Intergenic
1189941217 X:46123553-46123575 GACATTCTCAATTTAATAAAGGG - Intergenic
1192412701 X:70948572-70948594 GACCCTGTCTCTACAAAAAATGG - Intergenic
1193138053 X:77995137-77995159 GACACTTACACTTAAAAAATGGG - Intronic
1193903036 X:87206212-87206234 GAAATTTTCAATTTAAAAAATGG + Intergenic
1194382156 X:93207049-93207071 GACAAAGACACTATAAAAAAAGG + Intergenic
1195055623 X:101141743-101141765 GACCCTGTCTCAATAAAAAAGGG - Intronic
1195250856 X:103045490-103045512 TACACTGTCTCTTAAATAAACGG - Intergenic
1196052768 X:111322824-111322846 GACACTGTAACTTCAGAAGATGG + Intronic
1196063442 X:111436104-111436126 GACATTGTCATTTTAAAAGCTGG - Intergenic
1196853383 X:119960454-119960476 GACCCTGTCACTACAAAAAAAGG + Intergenic
1196858927 X:120009249-120009271 GACCCTGTCACTACAAAAAAAGG - Intergenic
1196987847 X:121294643-121294665 GACTCTGTCACCAAAAAAAAAGG - Intergenic
1197584743 X:128331578-128331600 GACACTCACACATTAAAAGAGGG - Intergenic
1197848440 X:130830333-130830355 GATATTGTCACTTTAAAGAGTGG - Intronic
1197903250 X:131395759-131395781 GACACTGTCGCTCCAAAATAAGG - Intronic
1198174903 X:134145554-134145576 GACTCTGTCTCTAAAAAAAAGGG - Intergenic
1198248729 X:134858052-134858074 GACACTTTTACTGTAAAAATAGG + Intergenic
1198785142 X:140279404-140279426 GACAAAGTCACATCAAAAAAAGG - Intergenic
1198910182 X:141605063-141605085 GACACTTCTATTTTAAAAAAAGG + Intronic
1200007284 X:153095767-153095789 GACACTGACACAACAAAAAAGGG - Intergenic
1200415759 Y:2908136-2908158 GACCTTATCTCTTTAAAAAATGG - Intronic
1200620160 Y:5434905-5434927 GAGACAGGCACTTTAAAGAAGGG + Intronic
1201595011 Y:15658579-15658601 GGACCTGTCACTTTAAAAAAAGG - Intergenic