ID: 1066981178

View in Genome Browser
Species Human (GRCh38)
Location 10:42418100-42418122
Sequence CCCTGGGCCTTGAGTGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066981178_1066981184 11 Left 1066981178 10:42418100-42418122 CCTATTTCACTCAAGGCCCAGGG No data
Right 1066981184 10:42418134-42418156 AGCAGGTAGTGAAGCCAGCCAGG 0: 9
1: 37
2: 130
3: 330
4: 809
1066981178_1066981183 -6 Left 1066981178 10:42418100-42418122 CCTATTTCACTCAAGGCCCAGGG No data
Right 1066981183 10:42418117-42418139 CCAGGGGCTCTACAATTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066981178 Original CRISPR CCCTGGGCCTTGAGTGAAAT AGG (reversed) Intergenic
No off target data available for this crispr