ID: 1066990202

View in Genome Browser
Species Human (GRCh38)
Location 10:42505900-42505922
Sequence CAGGATCTTCACCTCCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066990202_1066990207 10 Left 1066990202 10:42505900-42505922 CCTATATGGAGGTGAAGATCCTG No data
Right 1066990207 10:42505933-42505955 GGCAGAATGTGGACACCAGTGGG No data
1066990202_1066990206 9 Left 1066990202 10:42505900-42505922 CCTATATGGAGGTGAAGATCCTG No data
Right 1066990206 10:42505932-42505954 TGGCAGAATGTGGACACCAGTGG No data
1066990202_1066990205 -1 Left 1066990202 10:42505900-42505922 CCTATATGGAGGTGAAGATCCTG No data
Right 1066990205 10:42505922-42505944 GCACATCACATGGCAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066990202 Original CRISPR CAGGATCTTCACCTCCATAT AGG (reversed) Intergenic
No off target data available for this crispr