ID: 1066994754

View in Genome Browser
Species Human (GRCh38)
Location 10:42553215-42553237
Sequence TGGTGCCGCCGCGGCGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066994754_1066994757 -4 Left 1066994754 10:42553215-42553237 CCCGCTGCGCCGCGGCGGCACCA No data
Right 1066994757 10:42553234-42553256 ACCACCTCCACTTGCGCCTGTGG No data
1066994754_1066994761 10 Left 1066994754 10:42553215-42553237 CCCGCTGCGCCGCGGCGGCACCA No data
Right 1066994761 10:42553248-42553270 CGCCTGTGGCTCCACTTGCTTGG No data
1066994754_1066994765 24 Left 1066994754 10:42553215-42553237 CCCGCTGCGCCGCGGCGGCACCA No data
Right 1066994765 10:42553262-42553284 CTTGCTTGGTTCTGGTCCACTGG No data
1066994754_1066994763 16 Left 1066994754 10:42553215-42553237 CCCGCTGCGCCGCGGCGGCACCA No data
Right 1066994763 10:42553254-42553276 TGGCTCCACTTGCTTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066994754 Original CRISPR TGGTGCCGCCGCGGCGCAGC GGG (reversed) Intergenic
No off target data available for this crispr