ID: 1066994757

View in Genome Browser
Species Human (GRCh38)
Location 10:42553234-42553256
Sequence ACCACCTCCACTTGCGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066994748_1066994757 20 Left 1066994748 10:42553191-42553213 CCAGACACGGTCGGTTCCTGTGG No data
Right 1066994757 10:42553234-42553256 ACCACCTCCACTTGCGCCTGTGG No data
1066994754_1066994757 -4 Left 1066994754 10:42553215-42553237 CCCGCTGCGCCGCGGCGGCACCA No data
Right 1066994757 10:42553234-42553256 ACCACCTCCACTTGCGCCTGTGG No data
1066994753_1066994757 -3 Left 1066994753 10:42553214-42553236 CCCCGCTGCGCCGCGGCGGCACC No data
Right 1066994757 10:42553234-42553256 ACCACCTCCACTTGCGCCTGTGG No data
1066994755_1066994757 -5 Left 1066994755 10:42553216-42553238 CCGCTGCGCCGCGGCGGCACCAC No data
Right 1066994757 10:42553234-42553256 ACCACCTCCACTTGCGCCTGTGG No data
1066994750_1066994757 4 Left 1066994750 10:42553207-42553229 CCTGTGGCCCCGCTGCGCCGCGG No data
Right 1066994757 10:42553234-42553256 ACCACCTCCACTTGCGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066994757 Original CRISPR ACCACCTCCACTTGCGCCTG TGG Intergenic
No off target data available for this crispr