ID: 1066994765

View in Genome Browser
Species Human (GRCh38)
Location 10:42553262-42553284
Sequence CTTGCTTGGTTCTGGTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066994760_1066994765 -2 Left 1066994760 10:42553241-42553263 CCACTTGCGCCTGTGGCTCCACT No data
Right 1066994765 10:42553262-42553284 CTTGCTTGGTTCTGGTCCACTGG No data
1066994756_1066994765 15 Left 1066994756 10:42553224-42553246 CCGCGGCGGCACCACCTCCACTT No data
Right 1066994765 10:42553262-42553284 CTTGCTTGGTTCTGGTCCACTGG No data
1066994753_1066994765 25 Left 1066994753 10:42553214-42553236 CCCCGCTGCGCCGCGGCGGCACC No data
Right 1066994765 10:42553262-42553284 CTTGCTTGGTTCTGGTCCACTGG No data
1066994755_1066994765 23 Left 1066994755 10:42553216-42553238 CCGCTGCGCCGCGGCGGCACCAC No data
Right 1066994765 10:42553262-42553284 CTTGCTTGGTTCTGGTCCACTGG No data
1066994759_1066994765 1 Left 1066994759 10:42553238-42553260 CCTCCACTTGCGCCTGTGGCTCC No data
Right 1066994765 10:42553262-42553284 CTTGCTTGGTTCTGGTCCACTGG No data
1066994758_1066994765 4 Left 1066994758 10:42553235-42553257 CCACCTCCACTTGCGCCTGTGGC No data
Right 1066994765 10:42553262-42553284 CTTGCTTGGTTCTGGTCCACTGG No data
1066994754_1066994765 24 Left 1066994754 10:42553215-42553237 CCCGCTGCGCCGCGGCGGCACCA No data
Right 1066994765 10:42553262-42553284 CTTGCTTGGTTCTGGTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066994765 Original CRISPR CTTGCTTGGTTCTGGTCCAC TGG Intergenic
No off target data available for this crispr