ID: 1066996955

View in Genome Browser
Species Human (GRCh38)
Location 10:42572741-42572763
Sequence CAGTAGATCTTCAGGGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066996949_1066996955 3 Left 1066996949 10:42572715-42572737 CCCAGCATCTTGCCTCCAGGGTA No data
Right 1066996955 10:42572741-42572763 CAGTAGATCTTCAGGGATCAAGG No data
1066996950_1066996955 2 Left 1066996950 10:42572716-42572738 CCAGCATCTTGCCTCCAGGGTAT No data
Right 1066996955 10:42572741-42572763 CAGTAGATCTTCAGGGATCAAGG No data
1066996951_1066996955 -9 Left 1066996951 10:42572727-42572749 CCTCCAGGGTATGACAGTAGATC No data
Right 1066996955 10:42572741-42572763 CAGTAGATCTTCAGGGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066996955 Original CRISPR CAGTAGATCTTCAGGGATCA AGG Intergenic
No off target data available for this crispr