ID: 1066997823

View in Genome Browser
Species Human (GRCh38)
Location 10:42579964-42579986
Sequence TTGGTAAAAGGCAGAGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 2, 1: 0, 2: 1, 3: 28, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066997823_1066997830 -3 Left 1066997823 10:42579964-42579986 CCCCTATCTCTGCCTTTTACCAA 0: 2
1: 0
2: 1
3: 28
4: 280
Right 1066997830 10:42579984-42580006 CAATCGTGGAAAATGTGGTCTGG No data
1066997823_1066997832 15 Left 1066997823 10:42579964-42579986 CCCCTATCTCTGCCTTTTACCAA 0: 2
1: 0
2: 1
3: 28
4: 280
Right 1066997832 10:42580002-42580024 TCTGGTGTATTCACTGATGGAGG No data
1066997823_1066997833 19 Left 1066997823 10:42579964-42579986 CCCCTATCTCTGCCTTTTACCAA 0: 2
1: 0
2: 1
3: 28
4: 280
Right 1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG No data
1066997823_1066997831 12 Left 1066997823 10:42579964-42579986 CCCCTATCTCTGCCTTTTACCAA 0: 2
1: 0
2: 1
3: 28
4: 280
Right 1066997831 10:42579999-42580021 TGGTCTGGTGTATTCACTGATGG No data
1066997823_1066997828 -8 Left 1066997823 10:42579964-42579986 CCCCTATCTCTGCCTTTTACCAA 0: 2
1: 0
2: 1
3: 28
4: 280
Right 1066997828 10:42579979-42580001 TTTACCAATCGTGGAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066997823 Original CRISPR TTGGTAAAAGGCAGAGATAG GGG (reversed) Intronic
901245485 1:7727099-7727121 TTAATACAAGGCAGAGAAAGGGG - Intronic
902316124 1:15619864-15619886 TTGGGAAAAGACAGAGGTTGAGG + Intronic
903704919 1:25278708-25278730 TTCCTCAAAGGCAGAGAGAGGGG + Intronic
904697927 1:32340822-32340844 TAGGCAAAAGGCAGGAATAGGGG + Intergenic
906994152 1:50771992-50772014 TTGGGAAAAAGCAGAGATTATGG + Intronic
908548324 1:65184442-65184464 TAAGAAAAAGGCAAAGATAGTGG + Intronic
909321314 1:74289511-74289533 TTGGGAAAAGTCATAGAGAGAGG - Intronic
909935680 1:81547460-81547482 TTGGTAGAAGACAGAGAAATAGG - Intronic
910054742 1:83019780-83019802 TTGGTAAAAGGAAGAGTCAATGG - Intergenic
910830532 1:91456638-91456660 CTGCGAAAAGGCAGACATAGGGG - Intergenic
911480779 1:98437585-98437607 TGGGAAAAAGGCAGATAAAGAGG - Intergenic
912687134 1:111776389-111776411 ATTACAAAAGGCAGAGATAGAGG - Intronic
915560407 1:156683774-156683796 TTGGGGAAGGGGAGAGATAGTGG + Intergenic
916748683 1:167704272-167704294 TAGGTAAGAGGCCAAGATAGAGG + Intronic
917872351 1:179253324-179253346 TTAGTAAATAGCAGAGCTAGCGG + Intergenic
918571114 1:185994285-185994307 TCGATAAAAGGAAGAGATAGAGG + Intronic
920354066 1:205357157-205357179 TGGGTAAAAGGCAGAGAAGTGGG + Intergenic
920860752 1:209704545-209704567 TTTGTCAAAGACAGAGAGAGAGG - Intronic
921039368 1:211415609-211415631 CTGGTAGAATGCAGAGAAAGGGG + Intergenic
922884388 1:229006898-229006920 TTGGCTAAAGGCAGAGTGAGTGG - Intergenic
923680395 1:236113921-236113943 TTGGACACAGACAGAGATAGAGG - Intergenic
1062813680 10:483800-483822 TTGGTAAAATGAAGTCATAGAGG - Intronic
1063147265 10:3307463-3307485 TTGATAAAATGCAGAGATTTAGG + Intergenic
1063373584 10:5538101-5538123 ATGGTGAAAGGAAGAGAGAGAGG - Intergenic
1063975323 10:11410572-11410594 GAGGTAAAAGGCAGGGAGAGAGG + Intergenic
1063983882 10:11480371-11480393 TTAGTAAAAGTCAAATATAGAGG - Intronic
1066694688 10:38067216-38067238 TTGGTAAAAGGCAGAGATAGGGG + Intergenic
1066997823 10:42579964-42579986 TTGGTAAAAGGCAGAGATAGGGG - Intronic
1068065618 10:52127061-52127083 GTGGTGCAGGGCAGAGATAGTGG + Intronic
1068853192 10:61768342-61768364 TTGGTAAAATGTAGAGAAAGAGG - Intergenic
1069335350 10:67342610-67342632 TTTGTATATGGAAGAGATAGGGG + Intronic
1071296248 10:84222209-84222231 TTTGTAACAGGCAGAGATGCTGG - Exonic
1071773623 10:88759442-88759464 GTGGTTAAAGGCAGAAATGGAGG - Intergenic
1072274509 10:93809870-93809892 TTGCTAAAAGACAGAGATACAGG - Intergenic
1073112303 10:101069992-101070014 TGGGGACAGGGCAGAGATAGAGG + Intergenic
1073584825 10:104699676-104699698 TAGGTAAAAGGAGGAGAAAGGGG + Intronic
1073732543 10:106306966-106306988 CTGGAAAAAGGCAATGATAGCGG + Intergenic
1074140712 10:110669786-110669808 TTAGTAAAAGGTAGGGATTGGGG + Intronic
1074529689 10:114288788-114288810 TGGCTAAAAGGAAGACATAGAGG + Intronic
1074836695 10:117303070-117303092 TGGGTAAAAGGCAGAGAGGTTGG + Intronic
1077480927 11:2814224-2814246 ATGGATAAATGCAGAGATAGAGG + Intronic
1079691718 11:23426785-23426807 TTTGTAAAATGCTAAGATAGTGG - Intergenic
1079994293 11:27279339-27279361 TTCTTTAAGGGCAGAGATAGTGG - Intergenic
1081078441 11:38707145-38707167 TAGGTAAAAGGTAGAGTGAGTGG - Intergenic
1081439474 11:43064589-43064611 TTGGTAAAAGCTAAAGATAATGG - Intergenic
1081701425 11:45155209-45155231 TTGGGGAAAGTGAGAGATAGTGG - Intronic
1082160928 11:48886788-48886810 TTGGTGAAAGAGAGAGAGAGAGG + Intergenic
1082161438 11:48893618-48893640 TTGGTGAAAGAGAGAGAGAGAGG - Intergenic
1082191233 11:49247765-49247787 TTGGGAGAAGGCAGACAAAGTGG - Intergenic
1083110190 11:60398722-60398744 TTTTTAATAGTCAGAGATAGTGG - Intronic
1087229338 11:95642149-95642171 TAGCTAAAAGGAAGAGAGAGAGG + Intergenic
1087469771 11:98557660-98557682 GTGGTAGAAGGAAGAAATAGCGG - Intergenic
1087554641 11:99700808-99700830 TTGTCAAAAGGCAGAGAGTGGGG + Intronic
1088117292 11:106327138-106327160 TTGGTCACAGGCAGAGAGAGGGG + Intergenic
1089119661 11:116124696-116124718 TGGGTAAAAGACAGAGACAATGG + Intergenic
1090723795 11:129503141-129503163 TTGTTAAAAGGCAGAATTAGGGG - Intergenic
1091241282 11:134053990-134054012 TTGGAAAAAGGAAGAGCTTGTGG - Intergenic
1093748916 12:22776435-22776457 GTGGTAAGAGGCAGAGGAAGGGG + Intergenic
1094392247 12:29964278-29964300 GTGGTAAAAAGCAGAGATGATGG + Intergenic
1094426583 12:30322649-30322671 CCTGTATAAGGCAGAGATAGGGG + Intergenic
1095344072 12:41128556-41128578 TTGCTAAAGGACAGAGAAAGAGG - Intergenic
1096320881 12:50611774-50611796 TTGCTAAAAGCCCGAGAGAGGGG - Intronic
1096416586 12:51419702-51419724 TTGGACAGAGGCAGAGGTAGGGG - Intronic
1098444591 12:70553114-70553136 TTGGAAATGGCCAGAGATAGTGG - Intronic
1100759816 12:97794906-97794928 TGGGCAAAAGGCAGGGAGAGGGG - Intergenic
1102204220 12:111079115-111079137 TTTGTAAAAGGCAGTGAGATGGG - Intronic
1104496523 12:129245661-129245683 TTTGTAAAAGGCAGTGAGAGTGG + Intronic
1104835972 12:131791066-131791088 TAGTTAAAAGGCAGTGATTGTGG + Intronic
1105980087 13:25510661-25510683 CTGGCAAAAGGAAGTGATAGTGG + Intronic
1106416874 13:29553155-29553177 TAAGTAAAAGGGAGAGAAAGAGG + Intronic
1106567700 13:30900607-30900629 TTTGTAGAAGGCAGAGTCAGTGG + Intergenic
1107936687 13:45351408-45351430 TAGGAAAAAGGGAGAGAAAGAGG + Intergenic
1108157827 13:47604554-47604576 CTGGGAAAAGGCAGAGACAAAGG + Intergenic
1108163460 13:47666991-47667013 GTGGTAACAGGAAGAGATAGAGG - Intergenic
1108547257 13:51508305-51508327 TTGGCAAAAGGTAGAGTTGGAGG - Intergenic
1108820237 13:54340747-54340769 TTAGTTTAAGGCAGATATAGAGG + Intergenic
1110087472 13:71399485-71399507 TTAGTAAAACACAGAGATATAGG + Intergenic
1110404402 13:75133751-75133773 TCTGTAAAAGAGAGAGATAGTGG - Intergenic
1111294135 13:86257697-86257719 GGGGTAAGAGGCAGAGAAAGGGG - Intergenic
1111904124 13:94235765-94235787 TTGGGAGAAAGCAGTGATAGTGG + Intronic
1112631922 13:101170908-101170930 TTGGTGAAAGACAGATATAAAGG - Intronic
1113261176 13:108564823-108564845 TTTGTATAAGGCAAAGATGGGGG + Intergenic
1114546725 14:23508477-23508499 TTGGAAAAAGGAAAACATAGAGG + Intronic
1115977702 14:39014870-39014892 TTGGTAAACGTTAGAAATAGTGG - Intergenic
1116553827 14:46277675-46277697 TTGGGAAAAGACAGAGAGACGGG - Intergenic
1116763880 14:49047490-49047512 TTGCTACAAGGCAGGGAGAGAGG + Intergenic
1116822804 14:49641887-49641909 TTGTTAACACACAGAGATAGTGG - Intergenic
1116866616 14:50036754-50036776 TTTGTAAAAGGGAGAAATAAGGG - Intergenic
1117737867 14:58785981-58786003 TTGGTTGAGGGCTGAGATAGAGG + Intergenic
1119297231 14:73542878-73542900 TTGTGGAAAGGAAGAGATAGAGG + Intronic
1119301467 14:73574736-73574758 TTGTGGAAAGGAAGAGATAGAGG + Intronic
1120668065 14:87330890-87330912 TTGGAAAAAGACATAGGTAGGGG - Intergenic
1120929189 14:89831074-89831096 TGGGTAAGAGGCTGAGATGGTGG + Intronic
1126575282 15:50190558-50190580 TTGCTAGAAGGCAGAGAGATTGG - Intronic
1127865418 15:63028735-63028757 TAGGGACAGGGCAGAGATAGGGG - Intergenic
1129665624 15:77577979-77578001 TGGGGGACAGGCAGAGATAGAGG + Intergenic
1130374523 15:83316830-83316852 TTTGTAAATGAGAGAGATAGAGG - Intergenic
1132342073 15:101085199-101085221 TTTGTAAATGGCAGAGGGAGAGG - Intergenic
1135124611 16:19798041-19798063 GGGGTAAGAGGCAGAGAAAGGGG + Intronic
1136487416 16:30582427-30582449 TAGGTAAAAAGCAGAGGTAGGGG - Exonic
1138103620 16:54274694-54274716 ATGTTTAAAGGCAGAGAAAGAGG + Intergenic
1138801927 16:60043202-60043224 TTTTTAAAAGGCAAAGATATTGG + Intergenic
1143677487 17:8446311-8446333 ATGGTAAAGGGCAGAGAAAGGGG - Intronic
1144475857 17:15588829-15588851 CTGGAAAAAGGCAGAGAACGTGG - Exonic
1146419822 17:32672927-32672949 TTAGTAAAAGGCAGAGAGCATGG + Intronic
1146579271 17:34022328-34022350 CTGGGAACAGCCAGAGATAGAGG - Intronic
1148713603 17:49699786-49699808 ATGGTAGAAGGAAGAGGTAGAGG + Intergenic
1149390444 17:56185060-56185082 TTGATAAAAAGCAAAGATGGCGG - Intronic
1149965652 17:61161472-61161494 TCTTTAAAAGACAGAGATAGTGG + Intronic
1150330732 17:64292382-64292404 TTACTTAAAGGAAGAGATAGTGG + Intergenic
1152274611 17:79349028-79349050 GTGGGAAGAGGGAGAGATAGAGG - Intronic
1155416610 18:25605697-25605719 TTGGTAAAGGGAAGCGATTGGGG + Intergenic
1158850531 18:61492043-61492065 GTGGTCTAAGCCAGAGATAGAGG - Intronic
1158864097 18:61620392-61620414 TGGGTAACAGGTAGAGAAAGAGG - Intergenic
1159102476 18:63971186-63971208 GTAGTAAAAGGAAGAGACAGAGG - Intronic
1159536134 18:69717592-69717614 TTAGTCACAGGCAGAGAGAGAGG + Intronic
1159575337 18:70169238-70169260 TTGAAAAAAGACAGAGATAGAGG - Intronic
1163367406 19:16883440-16883462 TTGGTAAAGGACATAGATAGCGG + Intergenic
1168478308 19:56694874-56694896 TAGGTATAAGGCAGGGAGAGTGG - Intergenic
925077173 2:1026700-1026722 TTTTTAAAAGGCAGAGCAAGTGG - Intronic
925869477 2:8256585-8256607 CTGGAAAAAGGAAGAGAAAGAGG - Intergenic
926076018 2:9943454-9943476 TTAGAAAAAGGAAGAGCTAGAGG - Intergenic
926913016 2:17869018-17869040 TTGGTAACAGCCAGAGGTTGAGG - Intergenic
927527055 2:23754075-23754097 TTGGTAAAAGACATAGATGTAGG + Intronic
927882029 2:26695722-26695744 TTGGGAAACGGCAGAGGAAGAGG - Intronic
929303947 2:40338120-40338142 TTGGATAAAGGGAGAGAGAGAGG - Intronic
929305037 2:40351700-40351722 TTGAAGAAAGGCAGTGATAGGGG + Intronic
929332622 2:40701846-40701868 TTTGTATAAGAGAGAGATAGTGG + Intergenic
929788015 2:45005871-45005893 AGGGTAAAAGGAAGAGACAGAGG + Exonic
930053978 2:47238059-47238081 GTGGAGAAAGGCAGAGAGAGGGG - Intergenic
931436724 2:62254004-62254026 GTGGTAAAAGACATAGAAAGAGG - Intergenic
934153482 2:89172496-89172518 TTGGTGACGGGCAGAGAGAGTGG + Intergenic
934213753 2:90009435-90009457 TTGGTGACGGGCAGAGAGAGTGG - Intergenic
937510912 2:122594059-122594081 TTTGTATAAGTCAGGGATAGGGG + Intergenic
937653411 2:124346631-124346653 TAGGTAAAATGGAGAGCTAGGGG + Intronic
938279960 2:130056890-130056912 GTGGGGAAAGGCAGAGATGGGGG - Intergenic
938561213 2:132473766-132473788 TCTGAAAGAGGCAGAGATAGTGG - Intronic
938601333 2:132843926-132843948 TTGGGGAAAGGCAGAGATAAAGG - Intronic
939512960 2:143129034-143129056 TTGCTAGAAGGCAGAGAAAGAGG + Intronic
941612614 2:167679662-167679684 TTAGTAAAAGACAGATCTAGAGG - Intergenic
941620948 2:167778297-167778319 TTGGTGGAAGGGAGAAATAGGGG - Intergenic
942587232 2:177494749-177494771 TAAGTAAAGGGCAGAGAGAGGGG - Intronic
943000114 2:182316454-182316476 TTGGTAAATGGCCCAGATAAGGG + Intronic
943885509 2:193212019-193212041 TTTTTAAAAAGCAGAGATAAAGG + Intergenic
943919411 2:193683916-193683938 ATGTTCAAAGGAAGAGATAGAGG - Intergenic
945559156 2:211316613-211316635 TTGGTAAAAGGACAAGAGAGAGG + Intergenic
947702733 2:232248404-232248426 ATGGGAAAAGGAACAGATAGTGG + Intronic
948021988 2:234741365-234741387 TGGGGAAAAGGCAGAGAAAATGG + Intergenic
948058772 2:235028704-235028726 GTGGTAAAGGGCAGAGAAAGAGG + Intronic
948420234 2:237854959-237854981 TTGGTATAAGGTAGAAATAAGGG - Intergenic
948719061 2:239884830-239884852 TGGGGATAGGGCAGAGATAGGGG + Intergenic
1169475747 20:5929831-5929853 TTTGTAAAGGGCAGTGATGGGGG + Intergenic
1170920504 20:20674482-20674504 TTGGTAAATGGAAGTGATAAAGG - Intronic
1171147846 20:22801408-22801430 CTGGTAACAGGCAGTGACAGGGG - Intergenic
1172685223 20:36748793-36748815 TTAATAAATGGCAGAGTTAGGGG + Intergenic
1172824703 20:37771482-37771504 TGGGTAAGAGGCAGAGAAGGTGG - Intronic
1173308756 20:41876937-41876959 ATGGTAAGAGCCAGAGATATCGG - Intergenic
1174861825 20:54098466-54098488 TTGGTAACAGACCCAGATAGGGG + Intergenic
1175319930 20:58078453-58078475 TTGGGAAAGGGCAGAGAGAGGGG + Intergenic
1175460334 20:59147559-59147581 TTGGGAAAAGGCAAAGATGTTGG + Intergenic
1176732443 21:10513225-10513247 TAGGTAGAAGGCAGAAATTGGGG + Intergenic
1178507653 21:33176148-33176170 GAGGTAAAAGGGAGAGAGAGTGG - Intergenic
1179474278 21:41633345-41633367 TGGGGAAAAGGCAGAGGTGGAGG + Intergenic
1180652111 22:17386472-17386494 TTGGAAACAGGCTGAGAAAGGGG - Intronic
1181004950 22:20008858-20008880 ATGGGGAAAGGCAGAGAAAGAGG + Intronic
1181363223 22:22354655-22354677 TTGGTCACAGGCAGGGATAAAGG - Intergenic
1181366046 22:22377759-22377781 TTGGTCACAGGCAGGGATAAAGG - Intergenic
1181372468 22:22429221-22429243 TTGGTCACAGGCAGGGATAAAGG - Intergenic
1181505611 22:23354381-23354403 TTGGTACAAGGCAGATTCAGGGG - Intergenic
1184044253 22:41962720-41962742 ATGGCAAATGTCAGAGATAGTGG + Intergenic
950357802 3:12426187-12426209 TTGTTATCAGGCATAGATAGGGG + Intronic
950870123 3:16220901-16220923 TTGGTAAAGGGCAGAGCCAAAGG - Intronic
951488009 3:23235698-23235720 TGGGTAAATGGCAGAGTTAGGGG + Intronic
954080415 3:48210314-48210336 TTTGGAAAAGGCTGAGATGGGGG + Intergenic
954505819 3:51071877-51071899 TTTGAAAAAGGCAGAGATGTTGG - Intronic
955012493 3:55032107-55032129 TTGGTGAAAGGCAGATGAAGTGG - Intronic
958457717 3:94352860-94352882 TTGGTATAATGCAGAGTTTGTGG - Intergenic
959018494 3:101162932-101162954 CTGGGAAAAGGCAGCGAAAGAGG + Intergenic
962012347 3:131404179-131404201 TTTTTAAAAGGGAGAGAAAGAGG - Intergenic
962160360 3:132992769-132992791 TTGGGAAAGAGCAGGGATAGCGG + Intergenic
965764465 3:172115342-172115364 TAGGGAAAGGGGAGAGATAGAGG + Intronic
965779244 3:172266749-172266771 TTCTTATAAGGCAGAGACAGAGG - Intronic
966138255 3:176725816-176725838 ATGGTAAAAGGCACAGACACAGG + Intergenic
966799762 3:183752157-183752179 ATGGTCAAAGGCAAAGATGGAGG - Exonic
966959752 3:184923394-184923416 ATGGAAAGAGGCAGAGACAGGGG - Intronic
967723978 3:192844478-192844500 TTGGTGAAAGGAAGGGACAGGGG - Intronic
967909062 3:194526147-194526169 TGGGTAAGAGGCAGGGACAGTGG - Intergenic
970106721 4:12594251-12594273 GTGGTCAAAGGGAGATATAGAGG - Intergenic
971919946 4:32925431-32925453 TTTGAAAAAGGCAGAGTTATTGG + Intergenic
972229918 4:37059912-37059934 TTTGTCAAAGGGAGAGTTAGAGG + Intergenic
973156609 4:46962926-46962948 CTTGTATATGGCAGAGATAGGGG - Intronic
973859533 4:55047748-55047770 ATGTTGAAAAGCAGAGATAGGGG - Intergenic
975221590 4:71818712-71818734 TTGGAAACAGGCAGAGAAGGAGG - Intergenic
975405809 4:73987949-73987971 TTGGCGAAAGGCAAAGGTAGAGG - Exonic
976687526 4:87831586-87831608 TAGGAAAAAGGCAGAGAGAATGG - Intronic
976878332 4:89885903-89885925 TTAGTAGAAGGAAGAAATAGTGG - Intronic
976946635 4:90778124-90778146 TTGGTTACAGGCAAAAATAGTGG - Intronic
978062156 4:104351743-104351765 GAGAGAAAAGGCAGAGATAGGGG - Intergenic
978274168 4:106928909-106928931 TTGGTGAAAGGGAGAGAGAGAGG + Intronic
980252878 4:130340406-130340428 TTGGTAAGAGAAAGAGATAAGGG - Intergenic
981212742 4:142128453-142128475 TTGGCTCAGGGCAGAGATAGTGG - Intronic
982288526 4:153758733-153758755 ATGGGACAAGGCAGAGAGAGGGG - Intronic
982358461 4:154493054-154493076 TTGGTCACAGGTAGAGATAACGG - Intergenic
983836022 4:172386390-172386412 ATGGTAGAGGGCAGAGAGAGAGG + Intronic
986646386 5:9920597-9920619 ATAGTAAAGGACAGAGATAGTGG + Intergenic
986806128 5:11310656-11310678 CTGGGGAAAGGCAGAGAAAGAGG - Intronic
987021162 5:13873226-13873248 GTGGGAAAAGGAAGAGATTGTGG - Intronic
987465450 5:18266568-18266590 TTGTTAAAAAGCAGATACAGTGG - Intergenic
988122132 5:26978547-26978569 TTTCTAAAAGGAAGAGATAGTGG + Intronic
988235179 5:28534482-28534504 TTGGTAAAAGGAAGAAATAAGGG - Intergenic
988438691 5:31207608-31207630 TTGGTAAAAGGAAGACTCAGTGG - Intronic
989400740 5:41005294-41005316 TTTGCAGAAGGCAGAGAAAGGGG - Intronic
989597344 5:43168771-43168793 TTGGGTAAAGGCAGTGTTAGCGG + Intronic
991661539 5:68955703-68955725 TTGGTGAGAGCCAGAGATGGTGG + Intergenic
991920133 5:71648314-71648336 GTGTTATAAGGCAGAGAAAGAGG + Intronic
992210705 5:74477230-74477252 CTGGCCAAAGGCAGAGACAGAGG + Intergenic
992216454 5:74529153-74529175 TTGGGAAAAGGCAGGAACAGTGG + Intergenic
993153753 5:84195170-84195192 TTGGTAATAAGAAAAGATAGTGG - Intronic
994253475 5:97564442-97564464 TTGCTAAATGGAAGAGACAGAGG + Intergenic
994974674 5:106787204-106787226 TTGTGAAAAGCCAGAGAAAGGGG - Intergenic
995067954 5:107883538-107883560 TTGGGAAAGGGAAGAGATGGGGG - Intronic
995949449 5:117692074-117692096 TTGGTTAGAGGGAGAAATAGAGG + Intergenic
997342857 5:133159402-133159424 CTACTAAAAGGCACAGATAGAGG + Intergenic
998654298 5:144159519-144159541 TTGCTAAAATTCAGAGATACGGG - Exonic
999213774 5:149914295-149914317 TTGGTTAGAGGCAGGGAGAGTGG - Intronic
999458207 5:151735822-151735844 TTGGTCAGAGGCAGAGGCAGAGG + Intergenic
999621174 5:153475872-153475894 TTGCTAAATGGCAGACACAGTGG + Intergenic
999903359 5:156111753-156111775 TTTGTTAAAAGCAGTGATAGAGG + Intronic
999961247 5:156757900-156757922 TTTGTAAAATGCAGAGATAATGG + Intronic
1000669104 5:164038439-164038461 TTGTGAAAAGGTAGAGAAAGAGG - Intergenic
1001244480 5:170095675-170095697 TAGGTAAAAGGCAGAGAGAAAGG - Intergenic
1001682217 5:173566622-173566644 TTGGTAAATGGCACAGCGAGAGG - Intergenic
1002022940 5:176376423-176376445 TTGGGAAAATGGAGAGATACTGG + Exonic
1004127684 6:12889368-12889390 TTTGAGACAGGCAGAGATAGAGG - Intronic
1004139498 6:13003109-13003131 TTGGGAAAAGAAAGAGAAAGGGG + Intronic
1004972882 6:20931428-20931450 CTGGTAAGAGGCAGAGTCAGGGG + Intronic
1004998457 6:21216741-21216763 TTGGTCAAAGGAAGAAAAAGTGG - Intronic
1005278665 6:24246808-24246830 TTGGTAAATGGGAAAGACAGAGG + Intronic
1006600726 6:35223813-35223835 GTGGTAAAAGGAGGAGATACTGG + Intronic
1007949736 6:45860635-45860657 TTAGTTAAAGGCAGAGATTAGGG - Intergenic
1009700537 6:67172369-67172391 TTGATAAAAAGAAGAAATAGAGG + Intergenic
1011844505 6:91546682-91546704 TTGTTAAAAAGAAGAGACAGGGG + Intergenic
1012529692 6:100220645-100220667 TTGTTCAAAGGCAGACATTGAGG + Intergenic
1013307438 6:108862633-108862655 TTGGCAAAGGGCAGAGATAGGGG + Intronic
1017031417 6:150226408-150226430 ATGGTAAAAATCAGAGATGGGGG + Intronic
1017764889 6:157598395-157598417 TTGGTGAAATGAAGAGATAGCGG - Intronic
1020472041 7:8548512-8548534 TGGGTAATAGAGAGAGATAGAGG + Intronic
1020523053 7:9219122-9219144 TTGGTAAAATACAGATAAAGTGG + Intergenic
1022138039 7:27467467-27467489 TGGGTAAAAGGCTGAGAAACAGG - Intergenic
1022166951 7:27776247-27776269 CTGGTAAAATGCATAGATAAAGG + Intronic
1022923100 7:35036450-35036472 TTGGTAAATGGCAGAGGGAGGGG + Intronic
1024361178 7:48470162-48470184 TTCATAAAAGGGAGAGACAGAGG - Intronic
1024443675 7:49452560-49452582 ATGGTAAAAGACAGAAATGGTGG - Intergenic
1026297809 7:69070602-69070624 TTAGTGAAAGGCATAGCTAGAGG - Intergenic
1026522665 7:71131101-71131123 TTGGGAAGAGGAAGAGGTAGTGG + Intergenic
1028046622 7:86128663-86128685 CTGGAAAAATGCAGAGAGAGTGG - Intergenic
1028883593 7:95907672-95907694 CTGGTAAAAGGCAGAGAATGAGG - Intronic
1030623469 7:111817702-111817724 TTAGTAAAAGACAGAAATATTGG - Intronic
1032252045 7:130266243-130266265 TTGGGAAAAAGCACAGAAAGAGG + Intergenic
1033627918 7:143129098-143129120 TTAGTAACTGGCAGAGTTAGGGG - Intergenic
1034574468 7:151985355-151985377 TGGGTCAAAGGCTCAGATAGAGG - Intronic
1034597143 7:152208303-152208325 TAGGTAGAAGGCAGAAATTGGGG - Intronic
1036008974 8:4699007-4699029 TTAATGAAAGGCATAGATAGTGG - Intronic
1036030217 8:4962758-4962780 TTGGGATATGGCAGAGAGAGGGG + Intronic
1036144860 8:6245501-6245523 GTGGTAAAAGACAGAGGTAGTGG + Intergenic
1036383777 8:8260066-8260088 TTGGCAAAAGGCAGAGGAAGAGG + Intergenic
1037281829 8:17249943-17249965 ATGGTAATAGACAGAGGTAGGGG + Intronic
1037455386 8:19058639-19058661 TAGGGAAAAGGAAGAGATACAGG - Intronic
1041726766 8:61025197-61025219 ATGGTATAAGGTAGAGAGAGAGG - Intergenic
1042480592 8:69297855-69297877 GTGGTAAAGGTCAGAGACAGAGG + Intergenic
1043163022 8:76870088-76870110 TTGGTATAAGGCAGACTTAAAGG - Intergenic
1043225308 8:77720075-77720097 TTGGAAAAAAGCATAGAAAGAGG + Intergenic
1043848805 8:85192193-85192215 TTGGTAAATGGAGTAGATAGTGG + Intronic
1045854214 8:106744285-106744307 GGAGTAAAAGGCAAAGATAGGGG - Intronic
1045905548 8:107340511-107340533 ATGCTAAAAGTCAGAGATTGAGG + Intronic
1046774013 8:118144677-118144699 GTGGGAAAAGGGAGAGAGAGAGG + Intergenic
1048269552 8:133017752-133017774 TTGGGAAAGGGAAGAGAAAGGGG - Intronic
1048604586 8:135954507-135954529 TTTTTAAAAAGCAGAAATAGTGG - Intergenic
1048660791 8:136598991-136599013 ATGGCAATAGGCAGAGAGAGAGG - Intergenic
1049333108 8:142065524-142065546 GTGGTGACAGGCAGAGATTGGGG + Intergenic
1049341969 8:142118031-142118053 TTGGTAGAAGACAGAGGTCGGGG + Intergenic
1050218979 9:3364375-3364397 TTTGTAAAAGGTAGAGATGCTGG - Intronic
1051019088 9:12518545-12518567 GTGGTAAAAGGCAGTAAAAGAGG - Intergenic
1051197994 9:14584929-14584951 TTGGTAAAAGGAGGAAATAAGGG - Intergenic
1051799620 9:20918049-20918071 TTGGTGAATTGCAGACATAGTGG + Intronic
1052042952 9:23760984-23761006 AAGGTAAAAGGCAGAGAAAAAGG - Intronic
1052831830 9:33221898-33221920 TTGGTCAAAGGCTGACCTAGTGG - Intronic
1055025602 9:71716789-71716811 ATGGGAAAAGTGAGAGATAGAGG - Intronic
1055779858 9:79808648-79808670 TAAATAAAATGCAGAGATAGTGG - Intergenic
1056994276 9:91442111-91442133 TTGTCATAAGGCAGGGATAGTGG + Intergenic
1058482360 9:105409126-105409148 CAGTTAAAAGGCAGAGTTAGTGG + Intronic
1059923938 9:119187253-119187275 TAGGTAACAGGCAGCCATAGTGG - Intronic
1060899789 9:127246959-127246981 ATGTTAATAGGCAGAGATTGGGG + Intronic
1186374443 X:8983558-8983580 TGAGTAAATGGCAGAGAAAGAGG + Intergenic
1186448029 X:9648544-9648566 TTGGAAGAAGTCAGAGAAAGAGG - Intronic
1186911223 X:14168640-14168662 TTTGTATATGGCAGAGATAGGGG + Intergenic
1186927368 X:14349862-14349884 TTTGTATATGGCAGAGATAGGGG - Intergenic
1187927536 X:24263673-24263695 TTGGTAGCAGTCAGAGACAGAGG - Intergenic
1188324785 X:28787925-28787947 TTTGTATAAGACTGAGATAGTGG - Intronic
1188348957 X:29103440-29103462 TTTGTAAATGGTCGAGATAGAGG - Intronic
1188779777 X:34267503-34267525 TTAGGTAAATGCAGAGATAGAGG - Intergenic
1189291172 X:39887114-39887136 TTGGTAAAAGGTGGTGATATAGG + Intergenic
1190436000 X:50426095-50426117 TGGGAAAAGGGCAGAGATAATGG - Intronic
1193976028 X:88119612-88119634 TGGGTAAAAGGCAATGAAAGGGG - Intergenic
1196047448 X:111271023-111271045 TTGGTCAAAGACAGAGAGAAGGG + Intergenic
1196397754 X:115284080-115284102 TTTGGAAAAGGAAGAAATAGAGG + Intergenic
1197391854 X:125877616-125877638 TTTGTAAAGGGGAGAGAGAGTGG - Intergenic
1197585159 X:128337933-128337955 TAGGTAAAGGACAGAGACAGAGG + Intergenic
1199121398 X:144058589-144058611 TTAGTTAAATGCAGATATAGAGG - Intergenic
1199344105 X:146719037-146719059 TTCGTAAATGGCAGAACTAGAGG + Intergenic
1201672967 Y:16545168-16545190 TAGGTAAAAGACAGAGATCTTGG + Intergenic