ID: 1066997824

View in Genome Browser
Species Human (GRCh38)
Location 10:42579965-42579987
Sequence ATTGGTAAAAGGCAGAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066997824_1066997828 -9 Left 1066997824 10:42579965-42579987 CCCTATCTCTGCCTTTTACCAAT No data
Right 1066997828 10:42579979-42580001 TTTACCAATCGTGGAAAATGTGG No data
1066997824_1066997834 30 Left 1066997824 10:42579965-42579987 CCCTATCTCTGCCTTTTACCAAT No data
Right 1066997834 10:42580018-42580040 ATGGAGGAAGGAAGTTAAATTGG No data
1066997824_1066997830 -4 Left 1066997824 10:42579965-42579987 CCCTATCTCTGCCTTTTACCAAT No data
Right 1066997830 10:42579984-42580006 CAATCGTGGAAAATGTGGTCTGG No data
1066997824_1066997833 18 Left 1066997824 10:42579965-42579987 CCCTATCTCTGCCTTTTACCAAT No data
Right 1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG No data
1066997824_1066997832 14 Left 1066997824 10:42579965-42579987 CCCTATCTCTGCCTTTTACCAAT No data
Right 1066997832 10:42580002-42580024 TCTGGTGTATTCACTGATGGAGG No data
1066997824_1066997831 11 Left 1066997824 10:42579965-42579987 CCCTATCTCTGCCTTTTACCAAT No data
Right 1066997831 10:42579999-42580021 TGGTCTGGTGTATTCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066997824 Original CRISPR ATTGGTAAAAGGCAGAGATA GGG (reversed) Intronic
No off target data available for this crispr