ID: 1066997827

View in Genome Browser
Species Human (GRCh38)
Location 10:42579976-42579998
Sequence CATTTTCCACGATTGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066997827_1066997833 7 Left 1066997827 10:42579976-42579998 CCTTTTACCAATCGTGGAAAATG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG No data
1066997827_1066997834 19 Left 1066997827 10:42579976-42579998 CCTTTTACCAATCGTGGAAAATG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1066997834 10:42580018-42580040 ATGGAGGAAGGAAGTTAAATTGG No data
1066997827_1066997835 20 Left 1066997827 10:42579976-42579998 CCTTTTACCAATCGTGGAAAATG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1066997835 10:42580019-42580041 TGGAGGAAGGAAGTTAAATTGGG No data
1066997827_1066997832 3 Left 1066997827 10:42579976-42579998 CCTTTTACCAATCGTGGAAAATG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1066997832 10:42580002-42580024 TCTGGTGTATTCACTGATGGAGG No data
1066997827_1066997831 0 Left 1066997827 10:42579976-42579998 CCTTTTACCAATCGTGGAAAATG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1066997831 10:42579999-42580021 TGGTCTGGTGTATTCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066997827 Original CRISPR CATTTTCCACGATTGGTAAA AGG (reversed) Intronic
903383100 1:22910144-22910166 GATTTCCCAAGATTGGCAAAGGG + Intronic
903386811 1:22932399-22932421 CAGTTTCCACCATTGTGAAATGG - Intergenic
903474732 1:23611781-23611803 CAGTTTCCACAACTGGAAAATGG - Intronic
904150597 1:28435821-28435843 CAGTTTCCACTATTGTAAAATGG - Intronic
906521162 1:46467656-46467678 CGTTTTCCTAGATGGGTAAAAGG - Intergenic
910262205 1:85303627-85303649 CATTTTGGACAATTGGCAAATGG + Intergenic
910951356 1:92652061-92652083 CATTATCCACAATAGCTAAAAGG + Intronic
911397613 1:97331531-97331553 CAGTTTCAACTATTGGTGAATGG - Intronic
912864268 1:113243283-113243305 CAGTTTCCACGATTGGGGGAAGG - Intergenic
917762655 1:178180311-178180333 AATTTTGCAAGAATGGTAAAGGG - Intronic
919040429 1:192380869-192380891 TACTTTCCCCGACTGGTAAATGG + Intergenic
920726559 1:208440967-208440989 CATTTTCAACAAATGGTAATGGG - Intergenic
924044575 1:240013896-240013918 CATTTTGCAAGATAGGTGAAGGG - Intergenic
924681880 1:246243855-246243877 CATTCTACACGTTTTGTAAAAGG + Intronic
924849693 1:247814246-247814268 CATTTTGCATTTTTGGTAAAAGG - Intergenic
1063329585 10:5143993-5144015 CATATTCCACAATTTGCAAAAGG + Intergenic
1066694684 10:38067204-38067226 CATGTTCCATGATTGGTAAAAGG + Intergenic
1066997827 10:42579976-42579998 CATTTTCCACGATTGGTAAAAGG - Intronic
1070742134 10:78910145-78910167 CAGTTTCCACATCTGGTAAAGGG + Intergenic
1072801996 10:98398629-98398651 CACTTTCCACGATGGGAAATGGG + Intronic
1073584277 10:104693676-104693698 CAGTTTCCTCAATTGTTAAATGG - Intronic
1075541783 10:123319615-123319637 CAGTTTCCACGCTTGTAAAATGG - Intergenic
1082089422 11:48077261-48077283 CATTTTCCAAGATGGCTAAGTGG + Intronic
1086046158 11:82534413-82534435 CATTTTTAACCATTGTTAAATGG + Intergenic
1088078945 11:105885936-105885958 AATTTCCCAGGATTGTTAAAGGG + Intronic
1090590548 11:128262416-128262438 CATTTCCCACAAATGGGAAAGGG - Intergenic
1092038690 12:5364016-5364038 CATTTTCCAAGATTATCAAAAGG + Intergenic
1093625189 12:21338174-21338196 CATTTTCCACACTTGATAACAGG + Intronic
1093887501 12:24479456-24479478 CATTTTCCTCAATTGCAAAACGG - Intergenic
1097583874 12:61492018-61492040 CTTTTTCCACTGTTAGTAAAAGG + Intergenic
1106143530 13:27031854-27031876 CATTGTCCATTATTGGTATAGGG - Intergenic
1106618696 13:31353837-31353859 TATTTTCCAGCATTGGAAAAGGG + Intergenic
1107000922 13:35544230-35544252 CATTTTCAACAATTCGTAACAGG + Intronic
1107949768 13:45451457-45451479 CATTTTCCATGTCTGGAAAATGG - Intergenic
1110481349 13:75981206-75981228 CATTTTCAAGCATAGGTAAAAGG + Intergenic
1112007478 13:95266692-95266714 CATCTTCCCCCATTAGTAAATGG + Intronic
1116066346 14:39987870-39987892 CATTTTCCCCTATTTGTCAAAGG - Intergenic
1116900806 14:50360970-50360992 CATTATTCACGATAGCTAAAAGG - Intronic
1121638239 14:95467987-95468009 CAGTTTCCAGGGTTGGCAAAAGG + Intronic
1122252683 14:100451059-100451081 CATTTTCCAAGAGTGAAAAAAGG + Intronic
1126025607 15:44443333-44443355 CATTTTTCACAATAGCTAAAAGG - Intronic
1126872437 15:53004202-53004224 CATTTTCCCTGATTTGTGAATGG + Intergenic
1126936757 15:53718361-53718383 CATTTTCCAGGATTGGAACCTGG + Intronic
1129955916 15:79636749-79636771 CATTTTCTTTGATTGCTAAAGGG - Intergenic
1133586154 16:7197640-7197662 CATTATCCACAATAGCTAAAAGG + Intronic
1133861082 16:9596122-9596144 CCTTTTCCACAATGGGAAAAAGG + Intergenic
1135483436 16:22842620-22842642 AATTTTCCGGGATTGATAAAAGG - Intronic
1137791494 16:51178446-51178468 CCTTTTCCACCATTTGCAAAAGG - Intergenic
1138250900 16:55501161-55501183 CAGTTTCCACACTTGGGAAAAGG - Intronic
1138820573 16:60254298-60254320 CATTTACCACGAGTGGTTAAGGG - Intergenic
1145759583 17:27418626-27418648 CATTTTCCACGACTGCCCAAAGG - Intergenic
1153258260 18:3195052-3195074 GATTTTCCAAGATTAGGAAATGG - Intronic
1155068461 18:22289918-22289940 CATTATTCACAATTGCTAAAAGG - Intergenic
1159273460 18:66184504-66184526 CAATTTCCACAATTTTTAAAAGG - Intergenic
1159684304 18:71398542-71398564 CATTTTCTATGATTGGTGACTGG + Intergenic
1159739047 18:72141931-72141953 CATATTCCACAATTGGCACATGG + Intergenic
1160273143 18:77406020-77406042 CATTTTACAAGATGGCTAAAGGG - Intergenic
1161656906 19:5521949-5521971 CATTTGCCACAATTTTTAAAAGG + Intergenic
1165594651 19:37002421-37002443 CCTTTTCCAACTTTGGTAAAAGG - Intergenic
1168074947 19:53975849-53975871 CAGTTTCCACGTTTGGGTAATGG + Intronic
925944887 2:8851659-8851681 CATTTCCCACAACTGGGAAAAGG - Intergenic
933361782 2:81295990-81296012 CATTTGTCATGTTTGGTAAATGG + Intergenic
935512936 2:103998523-103998545 CATTTTGCAGGATTGATGAATGG - Intergenic
937535491 2:122881542-122881564 CATTTTTCAAGTTTGGAAAAGGG + Intergenic
940537624 2:154966645-154966667 CCTTTTCCCTGATTGGGAAAAGG + Intergenic
941477340 2:165966351-165966373 CAGTTTCCACAACTGGGAAAAGG + Intergenic
942931098 2:181493542-181493564 CATTTGCCACTATAAGTAAACGG - Intronic
945250474 2:207761658-207761680 CATTTTTCCCCATTGGAAAAGGG - Intronic
1172772797 20:37391426-37391448 CATTTTCCCCCACTGGTAAATGG + Intronic
1173940287 20:46905224-46905246 CAGTTTCCATGTTTGTTAAATGG - Intronic
1174697551 20:52575481-52575503 CATTATCCACAATTGCCAAATGG + Intergenic
1176421797 21:6522140-6522162 TACTTTCCACGATTTGTGAAGGG + Intergenic
1176531552 21:7966552-7966574 CTTTTTCCACAATCTGTAAAGGG + Intergenic
1176692026 21:9925060-9925082 CATTTTAAAAGTTTGGTAAACGG + Intergenic
1177235679 21:18386641-18386663 CACTTTCCAAGATAGTTAAATGG + Intronic
1179697287 21:43130456-43130478 TACTTTCCACGATTTGTGAAGGG + Intergenic
950329056 3:12141702-12141724 CAATTTCCTCCTTTGGTAAATGG + Intronic
957913621 3:86656416-86656438 CATTTTCCTCAGTTGGGAAATGG - Intergenic
960025426 3:113003555-113003577 CATTTTCCCAGAATAGTAAAGGG + Exonic
967449348 3:189605512-189605534 CAATTTCCAGAATTGTTAAAAGG + Intergenic
967543756 3:190699303-190699325 CATGTACCACTATTGGTAACTGG - Intergenic
967731455 3:192910798-192910820 CATTTTCTATCATTGGAAAACGG + Intronic
970300117 4:14672344-14672366 CATTTTCCAAGAGTTGTAAGAGG + Intergenic
970915386 4:21328035-21328057 CTCTTTCCAGGATTGGTAACTGG + Intronic
972346912 4:38199978-38200000 CTTGTTCCAGGATTGGTATATGG - Intergenic
973553462 4:52058384-52058406 TAATTTCCATGCTTGGTAAATGG - Intronic
977849679 4:101810757-101810779 CATTTTCCACAAGTGCCAAAGGG + Intronic
978628186 4:110711616-110711638 CATTTTCCAAAAATGTTAAAAGG - Intergenic
983394132 4:167171429-167171451 CATTTTTCCCCATTGGGAAATGG - Intronic
986854149 5:11849495-11849517 CATTTTCCATGGTTTGCAAAGGG + Intronic
987907921 5:24103099-24103121 CATTTTCCACTGTTGGAGAATGG - Intronic
991056638 5:62327692-62327714 CATTTTACCCTAGTGGTAAAAGG + Intronic
991094289 5:62722895-62722917 CATCTTCCAAGATTGGTACAAGG - Intergenic
991992992 5:72359913-72359935 CAGTTTCCTCATTTGGTAAATGG + Intronic
996661566 5:126009639-126009661 CATTTTCCAGTGTTGGTAAAAGG + Intergenic
997767074 5:136515318-136515340 CAATTTCCAGGATAGGTGAAGGG + Intergenic
1002559255 5:180070657-180070679 CATATTCCACGATGTGCAAAAGG + Intronic
1002992858 6:2254073-2254095 CATTTTTGATGACTGGTAAAGGG + Intergenic
1007123298 6:39401470-39401492 CATTTTCCACTATGGGCAATTGG + Intronic
1010161207 6:72858444-72858466 CATGTTCCACAATAGGAAAATGG - Intronic
1011047660 6:83103512-83103534 AATTTTCCAAAATTGGTGAAAGG - Intronic
1013975916 6:116078367-116078389 CATTTTCCCAGATTGGTCAAGGG - Intergenic
1014987560 6:128030250-128030272 CATTTTACAGGCTTGGTAAAAGG + Intronic
1018286314 6:162242329-162242351 CATTTTCTGCCATTGGAAAAAGG - Intronic
1021119977 7:16788224-16788246 CATTATCCACAATAGCTAAAAGG - Intergenic
1024762977 7:52622767-52622789 CATTTTTCACAATTGCCAAAAGG + Intergenic
1029962123 7:104699243-104699265 CATTATCCACAATAGCTAAAAGG + Intronic
1030945468 7:115714078-115714100 TATTTTCCACCATTCATAAAGGG + Intergenic
1031757168 7:125659803-125659825 CAATGTCCAAAATTGGTAAAAGG + Intergenic
1037060606 8:14504916-14504938 CATTTTCTTTCATTGGTAAAGGG - Intronic
1037672994 8:21031151-21031173 CATTATTCACAATAGGTAAAAGG - Intergenic
1042506658 8:69567762-69567784 CATTATCCACAATAGGGAAAAGG - Intronic
1043103716 8:76082008-76082030 TATTTTCAACAATTTGTAAATGG - Intergenic
1043507295 8:80915185-80915207 CAGTTTCCTTGATTGTTAAACGG - Intergenic
1043717252 8:83503052-83503074 CATTTTGCACCTTTTGTAAAAGG + Intergenic
1044817131 8:96124846-96124868 CATTTTCCACATCTGGAAAATGG + Intergenic
1045989494 8:108288793-108288815 CATTTTCCACTACTGTTTAAGGG + Intronic
1047866884 8:129034644-129034666 CATTTTCCAACATTGCTAACTGG + Intergenic
1049069248 8:140344363-140344385 CATTTTCCCCATTTGGAAAAGGG - Intronic
1050097944 9:2087049-2087071 CATTTGCCATGACTGGTGAAAGG + Exonic
1050801641 9:9622761-9622783 CATTTTGCATACTTGGTAAAGGG + Intronic
1051032035 9:12692863-12692885 CATTTTTCACTGTTGGTATATGG + Intronic
1052021183 9:23527342-23527364 CAGTTTCCACACTTGGAAAAGGG - Intergenic
1053628964 9:39911151-39911173 CATTTTAAAAGTTTGGTAAACGG + Intergenic
1053777045 9:41554878-41554900 CATTTTAAAAGTTTGGTAAACGG - Intergenic
1054214923 9:62339551-62339573 CATTTTAAAAGTTTGGTAAACGG - Intergenic
1054364685 9:64323606-64323628 CATTTTAAAAGTTTGGTAAACGG + Intergenic
1054672558 9:67815798-67815820 CATTTTAAAAGTTTGGTAAACGG + Intergenic
1054931326 9:70638368-70638390 CAGTTTCCTCATTTGGTAAATGG + Intronic
1055336076 9:75234919-75234941 CTTTTTCCATGCTTGGTGAATGG - Intergenic
1059373840 9:113866118-113866140 CATTATTCACAATAGGTAAAAGG + Intergenic
1060609764 9:124952754-124952776 CATTTTCCACAAATTTTAAATGG - Intronic
1189395150 X:40614762-40614784 CATTTTTCACAACTGGGAAAAGG + Intergenic
1189593132 X:42536717-42536739 AATTCTTCACGATTGATAAAAGG - Intergenic
1191260686 X:58316850-58316872 CTTTTTGCAGGATTGGCAAAGGG + Intergenic
1191260747 X:58317706-58317728 CTTTTTGCAGGATTGGCAAAGGG + Intergenic
1192676824 X:73205523-73205545 CATTATTCACAATAGGTAAAAGG + Intergenic
1193295578 X:79828177-79828199 CATTTTTCACGATTGATATCTGG - Intergenic
1195862340 X:109395512-109395534 TTTTTTCCATGATTTGTAAACGG - Intronic
1195885498 X:109633304-109633326 CAGTTTCCTCGATTGTAAAATGG + Intronic
1197295515 X:124714210-124714232 CAGGTTACACAATTGGTAAAAGG + Intronic
1197375683 X:125679357-125679379 CATTTTGCACAATAAGTAAATGG + Intergenic
1197959364 X:131987482-131987504 CCTTTTTAACGATTGGTAACAGG - Intergenic