ID: 1066997833

View in Genome Browser
Species Human (GRCh38)
Location 10:42580006-42580028
Sequence GTGTATTCACTGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066997823_1066997833 19 Left 1066997823 10:42579964-42579986 CCCCTATCTCTGCCTTTTACCAA 0: 2
1: 0
2: 1
3: 28
4: 280
Right 1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG No data
1066997825_1066997833 17 Left 1066997825 10:42579966-42579988 CCTATCTCTGCCTTTTACCAATC 0: 2
1: 0
2: 2
3: 49
4: 686
Right 1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG No data
1066997829_1066997833 0 Left 1066997829 10:42579983-42580005 CCAATCGTGGAAAATGTGGTCTG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG No data
1066997824_1066997833 18 Left 1066997824 10:42579965-42579987 CCCTATCTCTGCCTTTTACCAAT No data
Right 1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG No data
1066997827_1066997833 7 Left 1066997827 10:42579976-42579998 CCTTTTACCAATCGTGGAAAATG 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066997833 Original CRISPR GTGTATTCACTGATGGAGGA AGG Intronic
No off target data available for this crispr