ID: 1066999776

View in Genome Browser
Species Human (GRCh38)
Location 10:42598682-42598704
Sequence CAGTGTAATTCCCTGTATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066999776_1066999777 10 Left 1066999776 10:42598682-42598704 CCGAGATACAGGGAATTACACTG 0: 1
1: 1
2: 0
3: 12
4: 116
Right 1066999777 10:42598715-42598737 AAATGTTGAAAAAGCCTGCCAGG 0: 2
1: 0
2: 3
3: 20
4: 285
1066999776_1066999778 11 Left 1066999776 10:42598682-42598704 CCGAGATACAGGGAATTACACTG 0: 1
1: 1
2: 0
3: 12
4: 116
Right 1066999778 10:42598716-42598738 AATGTTGAAAAAGCCTGCCAGGG 0: 2
1: 0
2: 0
3: 15
4: 244
1066999776_1066999780 26 Left 1066999776 10:42598682-42598704 CCGAGATACAGGGAATTACACTG 0: 1
1: 1
2: 0
3: 12
4: 116
Right 1066999780 10:42598731-42598753 TGCCAGGGATTAACCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066999776 Original CRISPR CAGTGTAATTCCCTGTATCT CGG (reversed) Intronic
900527351 1:3135740-3135762 CAGTGTGAATACCTGTTTCTCGG - Intronic
906703672 1:47878389-47878411 CAGTGTAATCCCTTCTGTCTAGG - Intronic
906769255 1:48470112-48470134 CTGTGTAATTCACTGTATAACGG - Intronic
910078175 1:83305271-83305293 CAGTGTAGTTTCCTTTATGTAGG + Intergenic
910702503 1:90091413-90091435 GAGTGTAAATCCCTGAATCGGGG + Intergenic
911455155 1:98112930-98112952 TACTGGAATTCACTGTATCTTGG + Intergenic
913210613 1:116579488-116579510 AGGAGTAATTGCCTGTATCTTGG + Exonic
916557966 1:165909491-165909513 CAGTCTGATTCCCCGTTTCTGGG + Intronic
919454468 1:197805003-197805025 CAGGGGAATTGCTTGTATCTGGG + Intergenic
920016063 1:202909860-202909882 CAGTGAAATAACCTGGATCTAGG - Intronic
920037426 1:203075362-203075384 CTCTGAAATTCCCTGTCTCTGGG - Intronic
920187704 1:204171702-204171724 TAGTGTAATTCCATCAATCTTGG + Intergenic
921226341 1:213023709-213023731 TAATGAGATTCCCTGTATCTTGG - Intergenic
923340297 1:233001048-233001070 CAGTGCAAGACCCTGTCTCTTGG - Intronic
924140266 1:241014968-241014990 CACGCTATTTCCCTGTATCTAGG - Intronic
1062909261 10:1201947-1201969 CAGTGTGTCTCCCTGGATCTTGG + Intronic
1066219558 10:33321922-33321944 CAGTGTATTTCGTTTTATCTGGG - Intronic
1066693004 10:38050352-38050374 CAGTGTAATTCCCTGTGTCTAGG + Intronic
1066999776 10:42598682-42598704 CAGTGTAATTCCCTGTATCTCGG - Intronic
1067276874 10:44843690-44843712 CAGTGGAATGCCCTGTAGCTTGG + Intergenic
1076585184 10:131542217-131542239 AAGTGTAATTCCCAGTGTCAGGG + Intergenic
1079025348 11:16943443-16943465 CTGTGTACTTTCCTGTATCGGGG - Intronic
1081349505 11:42032812-42032834 CTGGTTTATTCCCTGTATCTTGG - Intergenic
1084069301 11:66723878-66723900 AAGTGTAATTCCATTTCTCTCGG + Intronic
1084515041 11:69633160-69633182 CAGAGCAAGACCCTGTATCTAGG + Intergenic
1085453242 11:76650321-76650343 CAGTGGGATTCCCTGTAACCTGG + Intergenic
1086435521 11:86776379-86776401 CTGTATCATTCCCTATATCTGGG - Intergenic
1090697611 11:129264156-129264178 CAGTATAATCCCATGTATATGGG + Intronic
1094567381 12:31611925-31611947 CAGTATAGTTCCTTGAATCTAGG - Intergenic
1098840461 12:75471462-75471484 CACTCTCATTCACTGTATCTTGG - Intergenic
1101287622 12:103331791-103331813 CTATTTAATTCCATGTATCTAGG - Intronic
1102503010 12:113365673-113365695 TACTGTAATTCCCTGTATCAAGG + Intronic
1106360996 13:29030391-29030413 CAGTTTCCCTCCCTGTATCTGGG + Intronic
1106915011 13:34504122-34504144 AACTGTAATACCCTGTGTCTAGG - Intergenic
1107656732 13:42599049-42599071 CAGTGTAGTGCCCTGGGTCTAGG + Intronic
1110434250 13:75461677-75461699 CAGTGTAGCTACCTGTATGTAGG - Intronic
1113073324 13:106443754-106443776 CAGGGTAATTGCATGCATCTTGG - Intergenic
1116722351 14:48514765-48514787 AGGTGTAATTCCCAGTAGCTGGG + Intergenic
1117151192 14:52890034-52890056 CAGGAGAATTGCCTGTATCTTGG + Intronic
1119308733 14:73628960-73628982 CAGGAGAATTCCCTGTACCTGGG + Intergenic
1122001547 14:98660515-98660537 CAGTTTAATTCCATGTATTCAGG + Intergenic
1128006287 15:64244799-64244821 CAGAGTAAGACCCTGTATCAAGG + Intronic
1131533993 15:93218710-93218732 CAGTCTAATTTCCTATTTCTTGG - Intergenic
1134120940 16:11584873-11584895 AAGTGTAATTCACTGTCTTTGGG - Intronic
1136236248 16:28915335-28915357 AAGTGTGATTCCCAGCATCTGGG + Intronic
1138882133 16:61029612-61029634 CTGTCTAATTCCCTTTATCTTGG + Intergenic
1141866828 16:86755991-86756013 CAGGGGAATTCCTTGAATCTGGG + Intergenic
1143845269 17:9769027-9769049 CAGTGAAATTTCCTGTCTATGGG - Intergenic
1150531405 17:65986766-65986788 CAGTGAAGTTCCCAGTTTCTAGG - Intronic
1154033691 18:10777473-10777495 CACTATAATTCACTGAATCTTGG + Intronic
1155017787 18:21862900-21862922 AACTGAAATTCCCTGAATCTAGG - Intronic
1156067152 18:33157299-33157321 CAATGTAATTGCTTGTATCTAGG - Intronic
1156174151 18:34522343-34522365 CAGAGTATTTCCCTGTCTTTGGG - Intronic
1156457624 18:37303666-37303688 CTGTGTAGTTCCCTGTTCCTGGG - Intronic
1157164388 18:45344870-45344892 CAGTTTAATTCCAAATATCTGGG - Intronic
1157164980 18:45350506-45350528 CAGTTTAATTCCAAATATCTGGG + Intronic
1161597920 19:5161535-5161557 GAGTGTATCTCGCTGTATCTGGG + Intronic
927033291 2:19144932-19144954 CAGTCTTATTCCCTCTATCTAGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
933429797 2:82161569-82161591 CAGTGTCATTCCTTGTTGCTTGG - Intergenic
938240868 2:129741510-129741532 CAGAGTTGTTCCCTGTCTCTAGG + Intergenic
939771335 2:146323200-146323222 TATTGTAATTTCATGTATCTGGG - Intergenic
940892851 2:159051933-159051955 CAGTTTAAGTCCGTGTATTTTGG + Intronic
941251174 2:163165060-163165082 CATTGTCTTTCCCTGTAGCTTGG + Intergenic
942320817 2:174734135-174734157 TTGTGTAATTCCCTTTATGTAGG - Intergenic
1169073346 20:2747176-2747198 CCCTGTAATCCCCTGTAACTCGG + Intronic
1170157664 20:13283324-13283346 CAGTGCAAGTCACTGTATCTCGG + Intronic
1171210915 20:23316258-23316280 TAGTGTCATTCCCTGGATCCTGG - Intergenic
1174034028 20:47655237-47655259 AAGTTTAATTCCCTTTATCTGGG + Intronic
1175263411 20:57688747-57688769 CAGTTTGATTCCCTGGCTCTAGG - Intronic
1178496195 21:33088523-33088545 CAGGGTAATTCCCTGAATACAGG - Intergenic
1182936422 22:34227002-34227024 CAGGGTACGTCACTGTATCTAGG - Intergenic
1183995994 22:41632804-41632826 CAGAGTAAGACCCTGTCTCTTGG + Intronic
949795108 3:7841422-7841444 CAGTCTATTTCAGTGTATCTGGG - Intergenic
955102275 3:55861831-55861853 CAGTTTCCTTCCCTGTAACTTGG + Intronic
955939523 3:64134413-64134435 CATTGGAATTCCCTGTGTCTAGG + Intronic
956967854 3:74484110-74484132 CAGCCTAATTCCTTGTTTCTAGG - Intronic
963380171 3:144520078-144520100 AACTGTATTTCCCTGTTTCTTGG + Intergenic
967582069 3:191170759-191170781 CAGTCTAACTGCCTCTATCTGGG - Intergenic
971604165 4:28635935-28635957 CAGTGAAATCCCCTGAACCTAGG + Intergenic
972743414 4:41910084-41910106 CAGGGTAATTGCCTGAACCTAGG + Intergenic
975767053 4:77679786-77679808 GACTCTAATTCCCTGTATCATGG + Intergenic
977178158 4:93840101-93840123 CAGAGTATTTCACTCTATCTAGG - Intergenic
982921537 4:161280060-161280082 CAATGTAATTATCTGTAACTTGG + Intergenic
987676039 5:21073518-21073540 CACTGTAAGTCACTGCATCTGGG + Intergenic
990620324 5:57551959-57551981 CATTTTTATACCCTGTATCTGGG - Intergenic
993523114 5:88929379-88929401 TAGTGAATTTCCATGTATCTGGG - Intergenic
994101963 5:95903309-95903331 CAGGAGAATTGCCTGTATCTGGG - Intronic
995858322 5:116616256-116616278 CAGTGTAATTCTCTGAAGCCCGG + Intergenic
1000331733 5:160211204-160211226 CAGTGTACTTCTGTGTTTCTTGG + Intronic
1003825756 6:9949473-9949495 CAGTTTAGTTCCCTGAATATAGG - Intronic
1007084136 6:39131214-39131236 CAGGCTAATTCCTTGTTTCTCGG + Intergenic
1009436248 6:63621459-63621481 CAGTGTCATTCCCAATTTCTGGG - Intergenic
1009900503 6:69803094-69803116 CACAGAAATTCCCAGTATCTTGG + Intergenic
1012672243 6:102068705-102068727 CAGTGTAACCCCGTGTAACTTGG - Exonic
1014588580 6:123232414-123232436 CAGTTTAATTCCATGCAGCTTGG - Intronic
1015089207 6:129334205-129334227 CAGTGCAATGCCCTCTACCTTGG + Intronic
1016303642 6:142659187-142659209 CAGTATAATTGACTGTCTCTTGG + Intergenic
1016413100 6:143804278-143804300 CAGGGCCTTTCCCTGTATCTTGG + Intronic
1019730454 7:2626910-2626932 CAATGGAATTCCCTGTGTTTGGG - Intergenic
1021273736 7:18624117-18624139 CAGTGTCACTCACTGTACCTTGG + Intronic
1023604661 7:41918550-41918572 CAGTATAATGCCCTGTACCATGG - Intergenic
1024106508 7:46093282-46093304 CATTGTAAGACCCTGTATGTAGG - Intergenic
1027295948 7:76770445-76770467 CAGTGTAGTTTCCTTTATGTAGG + Intergenic
1028669937 7:93390270-93390292 CAGTTTAATTCCATTTATATAGG + Intergenic
1033180087 7:139168322-139168344 CAGTGTTATTCCATGTTTCTAGG + Exonic
1036278488 8:7378370-7378392 CAAAGGAATTCCCTGAATCTTGG - Intronic
1036343035 8:7933516-7933538 CAAAGGAATTCCCTGAATCTTGG + Intronic
1037435687 8:18860976-18860998 CAAAGTAATTCCCTGGATATTGG - Intronic
1038153542 8:24964691-24964713 CAGAGCAAGACCCTGTATCTAGG + Intergenic
1038598098 8:28908660-28908682 CAGTGGAATTGCCTGAACCTGGG + Intronic
1041818873 8:62006172-62006194 CAGTGTACATCACTGAATCTGGG + Intergenic
1042561848 8:70077912-70077934 CAGTCAAGTTTCCTGTATCTGGG + Intergenic
1043799779 8:84593642-84593664 CAGTGTAAATCTCTGTACATAGG + Intronic
1044094149 8:88041565-88041587 TATTGTCATTCCCTGCATCTTGG - Exonic
1046810760 8:118530856-118530878 CAGAGTAAGTCCCTGTCTCTAGG - Intronic
1048844451 8:138593900-138593922 CACTCTCATTCCCTGTAGCTTGG - Intronic
1048958769 8:139558346-139558368 GAATGTAAATCCCTGTGTCTTGG + Intergenic
1050985245 9:12073873-12073895 CATTGTAATTACCTGTATTTTGG - Intergenic
1051896277 9:21993274-21993296 CAGTGTAATTTCCTATAACCAGG - Intronic
1052034252 9:23662153-23662175 CTGTGTTATTCACTGTATCCTGG + Intergenic
1052131456 9:24853577-24853599 CTGTGTGGTTCCCTGTCTCTTGG - Intergenic
1057951554 9:99373121-99373143 CAGAGAAGTTCCCTGTTTCTTGG - Intergenic
1061980519 9:134100600-134100622 CAGTGCTGGTCCCTGTATCTAGG - Intergenic
1203650091 Un_KI270751v1:108864-108886 CAGTGAAATTCTTTGGATCTGGG + Intergenic
1187588689 X:20692079-20692101 CAGTAGAATTCCCTCTTTCTTGG + Intergenic
1189647880 X:43153962-43153984 CAGGGTAATTCCCTGTCTCCTGG + Intergenic
1195478921 X:105320489-105320511 AACTGTAATTCTCTGTCTCTGGG - Intronic
1197608956 X:128617038-128617060 CAGTTTTACTCCCTGGATCTTGG + Intergenic
1199824815 X:151488575-151488597 CAGGGTGAGTCCCAGTATCTGGG - Intergenic