ID: 1067004122

View in Genome Browser
Species Human (GRCh38)
Location 10:42645428-42645450
Sequence CCTTTTAAGCAGTCAGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067004122_1067004127 -1 Left 1067004122 10:42645428-42645450 CCGGCCACTGACTGCTTAAAAGG No data
Right 1067004127 10:42645450-42645472 GTGGCTGCATTCTTTCTCCAGGG No data
1067004122_1067004126 -2 Left 1067004122 10:42645428-42645450 CCGGCCACTGACTGCTTAAAAGG No data
Right 1067004126 10:42645449-42645471 GGTGGCTGCATTCTTTCTCCAGG No data
1067004122_1067004128 14 Left 1067004122 10:42645428-42645450 CCGGCCACTGACTGCTTAAAAGG No data
Right 1067004128 10:42645465-42645487 CTCCAGGGCTCAGACTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067004122 Original CRISPR CCTTTTAAGCAGTCAGTGGC CGG (reversed) Intergenic
No off target data available for this crispr