ID: 1067005248

View in Genome Browser
Species Human (GRCh38)
Location 10:42654821-42654843
Sequence CATTTTAAGCAATCAGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067005248_1067005251 -4 Left 1067005248 10:42654821-42654843 CCGGCCACTGATTGCTTAAAATG No data
Right 1067005251 10:42654840-42654862 AATGTGGCTGTTTCTTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067005248 Original CRISPR CATTTTAAGCAATCAGTGGC CGG (reversed) Intergenic
No off target data available for this crispr