ID: 1067008620

View in Genome Browser
Species Human (GRCh38)
Location 10:42690245-42690267
Sequence CTTCTCCTGCAGAATCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067008620_1067008628 1 Left 1067008620 10:42690245-42690267 CCCTCCAGATTCTGCAGGAGAAG No data
Right 1067008628 10:42690269-42690291 GGGAGGACTCCTCCTTGCCCTGG No data
1067008620_1067008634 27 Left 1067008620 10:42690245-42690267 CCCTCCAGATTCTGCAGGAGAAG No data
Right 1067008634 10:42690295-42690317 CACCTCCACTGCTGCCACCGAGG No data
1067008620_1067008629 4 Left 1067008620 10:42690245-42690267 CCCTCCAGATTCTGCAGGAGAAG No data
Right 1067008629 10:42690272-42690294 AGGACTCCTCCTTGCCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067008620 Original CRISPR CTTCTCCTGCAGAATCTGGA GGG (reversed) Intergenic
No off target data available for this crispr