ID: 1067008932

View in Genome Browser
Species Human (GRCh38)
Location 10:42691534-42691556
Sequence GGTAGAAAGGCAGCCCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067008932_1067008940 25 Left 1067008932 10:42691534-42691556 CCTACCTGGGCTGCCTTTCTACC 0: 1
1: 0
2: 0
3: 30
4: 248
Right 1067008940 10:42691582-42691604 CACAGCCACCAGCTTCAGTGAGG 0: 1
1: 0
2: 1
3: 24
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067008932 Original CRISPR GGTAGAAAGGCAGCCCAGGT AGG (reversed) Intergenic
900540809 1:3201782-3201804 GGTAGAAACAGAGGCCAGGTGGG - Intronic
900782768 1:4628786-4628808 GGCAGAGAGGCAGCCTGGGTTGG + Intergenic
902435700 1:16397078-16397100 GGTATAGAGGTAGTCCAGGTGGG + Exonic
903177132 1:21587859-21587881 GGGAGGAAGGCGGCCCAGGAAGG + Intergenic
903327920 1:22581983-22582005 GGTAGAAAGGGGGACCAGGCAGG - Intronic
903353629 1:22733027-22733049 GAAAGAAAGGCAGCCTAGGAGGG - Intronic
903608359 1:24591646-24591668 GGGAGACAGGAAGCCCAGGCAGG + Intronic
903921954 1:26806018-26806040 GGCTGGAAGGCAGCCCAGGCTGG + Intergenic
904371430 1:30049965-30049987 GGTAGGAAGGGAGGCCAGGCTGG - Intergenic
904774155 1:32896467-32896489 GGGAGGAAGGTAGCCCAGGTAGG - Intronic
906120471 1:43386853-43386875 GGTGCAGATGCAGCCCAGGTTGG - Exonic
906176920 1:43782528-43782550 GGCAGAAAAGCAGACCAGATGGG - Intronic
907324666 1:53629212-53629234 GGTAGAAAGGCATCTCAGGAGGG - Intronic
907850283 1:58249329-58249351 GGTGGGAATCCAGCCCAGGTGGG - Intronic
911659939 1:100489936-100489958 GGCAGAATGGAGGCCCAGGTTGG + Intronic
913941912 1:125118096-125118118 GGTAGAAGGCCAGCACAGCTTGG - Intergenic
917242909 1:172968568-172968590 GGTAGTAGGGGAGCCCAGGGTGG - Intergenic
919629996 1:199951171-199951193 GGTTGGAGGGCAGCCCAGGCTGG - Intergenic
922313275 1:224416520-224416542 TGTAGAAAAGCAGTCCAGGCTGG - Intronic
923252025 1:232186329-232186351 GGTAGAAAGCAAGGCCAGGTGGG - Intergenic
923728105 1:236524378-236524400 GGTGAGAAAGCAGCCCAGGTGGG - Intronic
1062856285 10:781050-781072 GGCAGGAAAGCAGCCCAGGAGGG - Intergenic
1064201375 10:13287866-13287888 GTTTGAAAGCCAGCCAAGGTGGG - Intronic
1066415372 10:35216387-35216409 GGAAGAAAGCAAGCCCAGGATGG - Intergenic
1066782600 10:38969645-38969667 GGTAGAAGGCCAGCACAGCTTGG - Intergenic
1067008932 10:42691534-42691556 GGTAGAAAGGCAGCCCAGGTAGG - Intergenic
1067770615 10:49120968-49120990 GGTAGGGAGGCTTCCCAGGTGGG - Intergenic
1069887578 10:71633747-71633769 TGTAGAAAGGCAACCCAGAGAGG + Intronic
1070637292 10:78139625-78139647 GGTGGGCAGGCAGCCCAGGGTGG + Intergenic
1070823356 10:79375943-79375965 GGGAGGTAGGCAGGCCAGGTTGG + Intergenic
1071731847 10:88256010-88256032 AGTAGAAAGGCAGCTCAGGGAGG + Intergenic
1073188205 10:101630196-101630218 GATACAAAGGCAGCCGAGGAAGG + Intronic
1074353340 10:112759120-112759142 GGTAGAAATGCATCCTTGGTTGG + Intronic
1074997240 10:118768260-118768282 AGAGGAAAGGCAGCCCAGGCCGG - Intergenic
1075816038 10:125265465-125265487 GGTGGAGAGACACCCCAGGTGGG + Intergenic
1076137908 10:128057432-128057454 TGGAGGAAGGCAGCCCATGTGGG + Intronic
1076693620 10:132236543-132236565 GCCAGGAAGGCAGCCCAGGAGGG + Intronic
1079187372 11:18249326-18249348 GTTAAATAGGCAGCCCAGCTGGG + Intergenic
1081203550 11:40248111-40248133 GGCAGAGAGGCATCCTAGGTAGG - Intronic
1082784646 11:57310216-57310238 GTTGGAAAGCCAGCCCAGCTTGG - Exonic
1083458467 11:62795134-62795156 GGTATAAGGGAAGCACAGGTGGG + Intronic
1085016849 11:73179306-73179328 GGGGGGTAGGCAGCCCAGGTGGG - Intergenic
1085567139 11:77524451-77524473 GGGAGAAAGGCGGTCCAGGTAGG - Intronic
1085841477 11:80016198-80016220 GGTGGACAGGAGGCCCAGGTTGG + Intergenic
1086573817 11:88315176-88315198 GCTGGTAAGGCAGGCCAGGTAGG + Intronic
1088917082 11:114235574-114235596 GGGAGAAAGCCAGGCCAGGGTGG - Intronic
1089541110 11:119189424-119189446 GGTAGAAGGTCATTCCAGGTGGG - Intronic
1089601806 11:119620585-119620607 GGTAGAGAGGAAGCCCAGTAGGG + Intergenic
1089640362 11:119843800-119843822 GGGGAAAGGGCAGCCCAGGTAGG + Intergenic
1092689543 12:11092433-11092455 GAGTGAAAGGCAACCCAGGTAGG + Intronic
1094292968 12:28872813-28872835 ATTAGAGAGTCAGCCCAGGTGGG - Intergenic
1094557956 12:31521820-31521842 GGTTGATAGGGAGGCCAGGTAGG - Intronic
1095926399 12:47583840-47583862 GGGAGGAAGGCAGACCATGTAGG + Intergenic
1096484717 12:51971168-51971190 GCTAGACAGTCTGCCCAGGTTGG + Intronic
1096500079 12:52059303-52059325 GCTGGAAAGGCTGCCCAGGAAGG - Exonic
1096522314 12:52191384-52191406 GGGAGAAAGGGACCCCAGGATGG - Intronic
1096765705 12:53887218-53887240 GGTAGAAAATCAGCCCAGGCTGG + Intergenic
1102549051 12:113677772-113677794 GGGTGAAGGGCATCCCAGGTAGG + Intergenic
1104203543 12:126615076-126615098 GGTATCAAGGCACCCCAAGTTGG - Intergenic
1104969014 12:132522836-132522858 GGGGGAAAGGCAGCGCAGGCCGG - Intronic
1106093382 13:26619907-26619929 GATAAAAAGGCAGCCAAGGAGGG - Intronic
1106360358 13:29025665-29025687 GAGGGAAAGGCAGCCCAGGAAGG + Exonic
1107893269 13:44932783-44932805 GGCAGAAATGCAGCCAAGTTTGG + Intergenic
1110917508 13:81041182-81041204 GGTACAAAGGCAACTCAAGTGGG + Intergenic
1112998661 13:105605140-105605162 TGAAGAAAAGCAGCCAAGGTTGG - Intergenic
1114403321 14:22430369-22430391 GGTGGCAATGCAGTCCAGGTAGG + Intergenic
1114697839 14:24644128-24644150 GGTAAAAAGGCAAACCAGGTCGG - Intergenic
1116385923 14:44329831-44329853 AGTAGAAGGGCATTCCAGGTAGG - Intergenic
1116845703 14:49862987-49863009 GGCAGAACGGCTGCCCAGCTCGG - Intergenic
1117155627 14:52937433-52937455 GGAAGAAAGGCATTCCAGGTTGG - Intronic
1117829227 14:59733541-59733563 GCTAGAATGCCAGCCCAGGAGGG - Intronic
1118289437 14:64505648-64505670 GGTAGAAAGGGAGACTGGGTGGG - Intronic
1118542222 14:66841223-66841245 GGAGGATAGGTAGCCCAGGTAGG + Intronic
1119190659 14:72679822-72679844 AGCAGACAGGCAGCCCAGGCCGG + Intronic
1120220942 14:81732190-81732212 GGGCAGAAGGCAGCCCAGGTCGG - Intergenic
1122398625 14:101453173-101453195 GGAAGAAAGGAATCCCAGGCTGG + Intergenic
1128781218 15:70359924-70359946 GGTGGAGAGGCAGACCAGGAAGG - Intergenic
1129307036 15:74672985-74673007 GGGAGAAAGGCATCTCAGGTAGG + Intronic
1129708854 15:77809983-77810005 GGGAGAAAGGCAGCCAGAGTGGG - Intronic
1130382136 15:83379906-83379928 GGCCGAAAGGGAGCCCAGGTCGG + Intergenic
1131185388 15:90269510-90269532 GGTAGAAGAGGAGCCCAGGAAGG - Intronic
1132897516 16:2236099-2236121 GAAAGCAAGGCAGCGCAGGTAGG - Exonic
1132984973 16:2761125-2761147 AGTAAAAAAGCAGCCCAGGATGG - Intronic
1133285119 16:4687083-4687105 GGCACAAAGGCAGCCCACGAGGG - Intronic
1136514856 16:30762027-30762049 GGAAGAGAGGGCGCCCAGGTGGG - Exonic
1136696646 16:32086034-32086056 GGTAGACAGCCAGCACAGCTTGG + Intergenic
1136797147 16:33029308-33029330 GGTAGACAGCCAGCACAGCTTGG + Intergenic
1137084544 16:36102720-36102742 GGTAGAAGGCCAGCACAGCTTGG + Intergenic
1137344603 16:47644405-47644427 TGTAGAACAGCAGCCCAAGTTGG - Intronic
1137401448 16:48156977-48156999 GGTAGGAAGGGAACTCAGGTTGG - Intergenic
1137643914 16:50058225-50058247 GGTAGACAGGGAGGCCAGGATGG + Intergenic
1138511672 16:57512364-57512386 CCTAGAGAGGCAGCCCAGGGTGG + Exonic
1140913092 16:79471109-79471131 AGCAGGAAGGCAGGCCAGGTAGG - Intergenic
1141204113 16:81920107-81920129 GGAATCAAGCCAGCCCAGGTGGG + Intronic
1141464232 16:84195928-84195950 GGCTGACAGGCAGCCCACGTGGG - Exonic
1142608918 17:1097077-1097099 GTTAGAAAGGCAGAGCAGGGAGG + Intronic
1143672574 17:8406521-8406543 GGTAGAAAGGCATTCCAGCCAGG - Intergenic
1143864438 17:9913656-9913678 GGTAGAAAGGAGGCCCAGGGTGG + Intronic
1144301442 17:13925562-13925584 GATAAAAAGGGAGCCCAGATTGG - Intergenic
1144748055 17:17628832-17628854 GGAAGAAAGGAAGCCCCAGTGGG + Intergenic
1145693881 17:26773196-26773218 GGTAGAAGGCCAGCACAGCTTGG - Intergenic
1145972873 17:28967273-28967295 GGGAGAAAGGCAGGCAAGGTAGG + Intronic
1146129933 17:30263493-30263515 GGGAGAAAAGAAACCCAGGTTGG + Intronic
1146260584 17:31417630-31417652 GGAAGGAATGCAGCCTAGGTGGG + Intronic
1148135400 17:45288738-45288760 GGTAGAAAGGAAGCCAGGGTGGG - Intronic
1148174847 17:45554771-45554793 ACTAGAAGGGCTGCCCAGGTTGG + Intergenic
1148215950 17:45834130-45834152 GGGAGAGAGGCAGCCCTGGGAGG - Intronic
1148296524 17:46508256-46508278 ACTAGAAGGGCTGCCCAGGTTGG - Intergenic
1149558669 17:57592806-57592828 GGAAGAAAGGCAACTGAGGTAGG - Intronic
1150406064 17:64901682-64901704 ACTAGAATGGCTGCCCAGGTTGG + Intronic
1150785068 17:68155655-68155677 ACTAGAAGGGCGGCCCAGGTTGG + Intergenic
1151227616 17:72658434-72658456 GGAAGAAAGGCATCCCCGGTGGG + Intronic
1151801467 17:76382290-76382312 TGGAGAAAGGCAGCCTGGGTTGG + Intronic
1152299004 17:79484626-79484648 AGGTGGAAGGCAGCCCAGGTTGG + Intronic
1152450288 17:80374339-80374361 GGTTTAAAGGCAGCCAAGCTGGG - Intronic
1152558003 17:81064124-81064146 GGAAGAAGGGCAGCCAGGGTTGG - Intronic
1153786177 18:8537350-8537372 AGGGGAAAGGCAGCCCAGGTAGG - Intergenic
1158324825 18:56302602-56302624 GGTAAAATGTCAGCACAGGTCGG - Intergenic
1158880284 18:61772112-61772134 GGGAGAGAGGCAGCCCAAGATGG - Intergenic
1161063851 19:2228105-2228127 GGCAGAGAGGCAGCAGAGGTGGG - Intronic
1161698590 19:5783508-5783530 GGTACAGGGGCACCCCAGGTCGG + Exonic
1163885754 19:19963353-19963375 TGGTGAAAGGAAGCCCAGGTTGG - Intergenic
1163888745 19:19992316-19992338 TGGTGAAAGGAAGCCCAGGTTGG + Intergenic
1164405509 19:27941931-27941953 GAGTGAAAGGCAGACCAGGTGGG + Intergenic
1164749106 19:30638162-30638184 GGCAGAAAGCCAGGCCAGGGTGG + Intronic
1165694414 19:37889701-37889723 GGTAGATAGGCACCCCAGCTGGG - Exonic
1166990301 19:46688898-46688920 GGTTGCAAAGCAGCCCAGGTTGG - Intronic
1202669474 1_KI270709v1_random:38826-38848 GGTAGAAGGCCAGCGCAGCTTGG - Intergenic
925872044 2:8279696-8279718 GGAAGAAAAGCGCCCCAGGTGGG - Intergenic
929886804 2:45886062-45886084 AGTGGCAAGACAGCCCAGGTAGG - Intronic
931445444 2:62323510-62323532 GGGAGAAGGGAAGCCCAGGGAGG - Intergenic
931840783 2:66145880-66145902 GGCAGAAAGGGAGACAAGGTAGG - Intergenic
932167236 2:69519390-69519412 GATAGAAAGACATTCCAGGTGGG - Intronic
932211014 2:69930430-69930452 GGTAGAAAGGATTCCAAGGTTGG - Intronic
932235676 2:70119359-70119381 GGCAGCAAAGCAGCCCAGGTTGG + Intergenic
934257626 2:91441951-91441973 GGTAGAAGGCCAGCACAGCTTGG - Intergenic
934304200 2:91808972-91808994 GGTAGAAGGCCGGCACAGGTTGG - Intergenic
934329055 2:92043778-92043800 GGTAGAAGGCCGGCACAGGTTGG + Intergenic
934476976 2:94600164-94600186 GGTAAGAAGGCAGACCAGGCTGG - Intronic
936370191 2:111897389-111897411 AGGAGACAGGCAGCCCAGATGGG - Intergenic
936922802 2:117706637-117706659 GGTACAGAGGCAGTCCAGATAGG + Intergenic
937842502 2:126537791-126537813 GGGTGAAAGACAGCCCAGGCTGG - Intergenic
938025113 2:127940864-127940886 AGTGGAAAGGCAGCTCAGATCGG - Intergenic
938516301 2:132010386-132010408 GGTAGAAGGCCAGCACAGCTTGG + Intergenic
939371518 2:141307661-141307683 GGTAGGAATGCATGCCAGGTGGG + Intronic
940009385 2:149038543-149038565 GGTTGAAAGGAGGCCCAGGCGGG - Exonic
940074000 2:149720389-149720411 GGCAGGAGGGCAGCCCAAGTTGG + Intergenic
940476338 2:154167775-154167797 GATAGAAAGGCAGCCTTGCTTGG + Intronic
944171629 2:196785914-196785936 GGAAGAAAGTGAGCCCAGGCGGG - Intronic
945977834 2:216284293-216284315 GGTAGCTAGGAAGCCCAGTTTGG + Intronic
947722523 2:232378567-232378589 CTGAGAAAGGCAGCTCAGGTTGG - Exonic
1169310230 20:4531865-4531887 GATGGAAAGGCAGGTCAGGTAGG - Intergenic
1169477950 20:5949706-5949728 GATAGAAAGCCAGACTAGGTAGG + Intronic
1169801007 20:9511651-9511673 GTAAGACAGGCATCCCAGGTGGG - Intergenic
1170347946 20:15407561-15407583 GGTAGAGAGGCAGCCTAGCACGG + Intronic
1172846999 20:37935487-37935509 GGTGGAAAGGCTGCCAGGGTCGG - Intronic
1173927697 20:46792982-46793004 GGAAGGAAGGCAGCCCATGCAGG + Intergenic
1173930584 20:46814682-46814704 GACAGAAAGCCAGCCCAGGTAGG - Intergenic
1177839071 21:26216745-26216767 GGTGGAAAAGCAGGTCAGGTGGG - Intergenic
1178913265 21:36693230-36693252 GTTAGAAACGCAGGCCAGGCAGG - Intergenic
1179547712 21:42123915-42123937 GGGACAGAGGGAGCCCAGGTGGG + Intronic
1179944966 21:44666941-44666963 GGTATAAAGGCTGCCCAGGGAGG - Intronic
1179946594 21:44682178-44682200 GGTATAAAGGCTACCCAGGGAGG - Intronic
1182316274 22:29449423-29449445 GGCAGGAAGGCAGCACAGGCTGG + Intergenic
1183616675 22:38950079-38950101 ACTAGAGAGGGAGCCCAGGTGGG + Intergenic
1184029524 22:41883755-41883777 GGAGGCAAGGCAGCCCAGGAGGG + Intronic
1184037918 22:41927214-41927236 GGTAGAAAGAGAGGCCAGGCCGG - Intergenic
1184118205 22:42434189-42434211 GGAAGACAGGCAGCTCAGGCAGG - Intergenic
1184688421 22:46106711-46106733 GGAAGGAAGGCAGCCCTGGAAGG + Intronic
1184755941 22:46515758-46515780 TGTAGGAAGGCAGCCCCGGCAGG + Intronic
1184919667 22:47596862-47596884 GGTAGAAAGCAAGTCCAAGTGGG - Intergenic
1184959876 22:47921251-47921273 GGTAGGAAGAGTGCCCAGGTGGG - Intergenic
949435843 3:4028418-4028440 GCAAGAAAGCAAGCCCAGGTGGG - Intronic
950635197 3:14309146-14309168 GGTAGAAAGGTGACCCAGGTGGG + Intergenic
951477143 3:23118945-23118967 GGTAGAGAGGGAGCCCTGGCTGG + Intergenic
952148741 3:30563034-30563056 GGTTGAAGGGCAGGCCAAGTAGG + Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954121271 3:48501499-48501521 GGGAGAGAGGGAGCCCAGTTAGG - Intronic
954951717 3:54480649-54480671 AGGAGGAAGGCAGCCCAAGTTGG - Intronic
958762821 3:98328997-98329019 GGCAGACAGGCAGCCCTGGCTGG - Intergenic
958927082 3:100170719-100170741 GGTAGAAAGGCAGGCACGGCAGG + Intronic
959740735 3:109716316-109716338 GCTCAAAAAGCAGCCCAGGTTGG - Intergenic
960972862 3:123151775-123151797 GGCAGGAAGGCAGGCCAGGCAGG - Intronic
963782364 3:149499032-149499054 TGCAGAAAACCAGCCCAGGTTGG + Intronic
964317072 3:155456405-155456427 GGGCTAAAGGCAGCCCAGGATGG - Intronic
964883180 3:161446987-161447009 GGAAGAATGGCAGGCCAGGCAGG + Intergenic
966682383 3:182656538-182656560 GGTAGAAAGCATGCCCAGGGAGG + Intergenic
967820244 3:193833290-193833312 GGGAGAAGGGCTTCCCAGGTGGG + Intergenic
968442067 4:629154-629176 GGCAGGAAGGAAGCACAGGTCGG + Intronic
968550954 4:1223161-1223183 GGTGGGCAGGAAGCCCAGGTTGG - Intronic
968877783 4:3283126-3283148 GGCAGTGAGGTAGCCCAGGTCGG - Intergenic
969392434 4:6900712-6900734 GGTAGAAACCCAGAACAGGTGGG - Intergenic
971402637 4:26290440-26290462 AGTAGAGAGCCAGCCCAGTTTGG + Intronic
972720430 4:41691311-41691333 GGTAGAAAGGCAGTGGAAGTTGG - Intronic
975512914 4:75212932-75212954 GGTAGAAAGGAAGGCCAGGAGGG + Intergenic
975777067 4:77798868-77798890 GCTACTAAGGCAGCCGAGGTAGG + Intronic
976979240 4:91205710-91205732 AGTAGAAAGGGAGGCCAGGTGGG - Intronic
977700104 4:100012273-100012295 GGAAGACAAGCAGCCCAGATAGG - Intergenic
978440690 4:108730315-108730337 GGGAAAGAGGCAGCCCAGCTTGG - Intergenic
981522783 4:145681047-145681069 GTTTGAAAGGCAGGCGAGGTGGG + Intronic
984510132 4:180669115-180669137 CGTAGGAAGGCAGCACAGATTGG + Intergenic
984991866 4:185388500-185388522 GGTAGATAGATAGCCTAGGTAGG - Intronic
986256685 5:6106774-6106796 GGTAGAGAGGCAGCCAAGGAGGG + Intergenic
990322848 5:54646904-54646926 TGGAGAAAGGCAGCACAGCTGGG - Intergenic
991253198 5:64586308-64586330 GGTATAAGGGCAGGCGAGGTGGG - Intronic
992004497 5:72463993-72464015 AGTAGAAAGGCTGCTCAGATTGG + Intronic
995522959 5:113028057-113028079 GGTATACAGTGAGCCCAGGTAGG + Intronic
997523303 5:134537016-134537038 GGAAGAAGGGCTGGCCAGGTGGG - Intronic
998355067 5:141528448-141528470 TGGAGAAAGCCAGCCGAGGTGGG - Exonic
999722604 5:154409838-154409860 GGTAGAAAGTCAGTGCAGGGAGG + Intronic
1000672208 5:164076935-164076957 AGGAGGAAGGCAGCCCTGGTGGG - Intergenic
1003871302 6:10404965-10404987 GGCAGAAACGCAGGCCAGGCTGG - Intronic
1005033979 6:21538343-21538365 GGGAGAAATGCAGCTCAGCTTGG + Intergenic
1005681226 6:28210404-28210426 GGTAGGAAGAAAGCCCAGGCAGG + Intergenic
1005706464 6:28459282-28459304 GGATGAAAGGCAGACCAGCTGGG - Intergenic
1006106391 6:31719387-31719409 GGAAGGAAGGAAGCCTAGGTGGG - Intronic
1006744635 6:36332717-36332739 GCTTGAAATGCTGCCCAGGTGGG - Intronic
1006823538 6:36917278-36917300 GATAGGCAGGCAGCCCAGCTGGG + Intronic
1011411124 6:87067661-87067683 TGCAGAAAGGCAGCTGAGGTAGG - Intergenic
1013230243 6:108156281-108156303 GGTTGAAAAGGAGCCCAGGTTGG + Intronic
1014150071 6:118044340-118044362 GAAAGACAGGAAGCCCAGGTGGG - Intronic
1014213932 6:118735265-118735287 GGTGGAATGTGAGCCCAGGTTGG + Intergenic
1018444244 6:163840729-163840751 GGAGGAGAGCCAGCCCAGGTTGG + Intergenic
1018906629 6:168079568-168079590 GGGAGGAAGGCAGCCTGGGTGGG + Intronic
1020444832 7:8258108-8258130 GGTGGTAATGCAGCCCAGGGCGG - Intronic
1020664594 7:11024244-11024266 GGTTGAAAGGTAGCAGAGGTTGG + Intronic
1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG + Intergenic
1022103340 7:27182116-27182138 GGTAGAAAGAAAAGCCAGGTGGG + Exonic
1023159564 7:37284141-37284163 GGGAGGAAGGAAGCCCTGGTTGG + Intronic
1024465065 7:49703546-49703568 GGGACAAAGGCAGCACATGTGGG - Intergenic
1025319988 7:58086381-58086403 GGTAGAAGGCCAGCACAGCTTGG - Intergenic
1025553724 7:62277095-62277117 GGTAGAATGCCAGCACAGCTTGG + Intergenic
1025561054 7:62376180-62376202 GGTAGAAGGCCAGCACAGCTTGG - Intergenic
1026511379 7:71030027-71030049 GGTAAACACGCAGCCCAGGATGG - Intergenic
1027190674 7:75994114-75994136 GCCCGAGAGGCAGCCCAGGTCGG - Intronic
1030105909 7:105987143-105987165 GGAAGGAAAGCTGCCCAGGTAGG + Intronic
1031813127 7:126397221-126397243 AGTAGGAAGGGAGCCCAGGCTGG - Intergenic
1032094477 7:128931150-128931172 TGTAGTAAGGCAGCCGGGGTAGG + Intergenic
1032228991 7:130057264-130057286 GGTAGAAATGTTGCCCAGGCTGG + Intergenic
1033520896 7:142159344-142159366 GTAAGTAAGGCAGCCCTGGTTGG + Intronic
1034880462 7:154758842-154758864 AGAAGAAAGGCAGCCCAGAGAGG + Intronic
1034962521 7:155371815-155371837 GGTAAAGAGGCAGCACAGGTTGG + Intergenic
1036730524 8:11258997-11259019 GGTAGAAAGCCAGCCCACGGCGG - Intergenic
1039448088 8:37648541-37648563 GGGAAAAAGGCAATCCAGGTGGG + Intergenic
1041103986 8:54424220-54424242 GTTCTAAAGGCAGCCCAGATAGG - Intergenic
1041881184 8:62751230-62751252 GGTGGATAAGGAGCCCAGGTGGG - Intronic
1043373532 8:79621518-79621540 GGAAGAAGGGCTGGCCAGGTGGG - Intronic
1046737673 8:117794363-117794385 GGTAGACAGGCAGATGAGGTTGG - Intergenic
1049377005 8:142294060-142294082 GGGAGTAAGGGAGCCCAGGGAGG + Intronic
1049425152 8:142534735-142534757 GGGACAGAGGCAGCCCAGGAAGG + Intronic
1050681989 9:8122228-8122250 GGGAGAAAGGGAGCTGAGGTTGG - Intergenic
1050831131 9:10015091-10015113 TATAGAAAAGCTGCCCAGGTAGG - Intronic
1052853053 9:33389738-33389760 GGTAAGAAGGCAGACCAGGCCGG + Intronic
1052939950 9:34125604-34125626 GGTAGAGATGCAGCCCATGTCGG - Intronic
1053437405 9:38085481-38085503 GGAAAAAAAGCAGCCCAGTTTGG + Intergenic
1053681092 9:40485928-40485950 GGTAAGAAGGCAGACCAGGCTGG + Intergenic
1053931080 9:43114242-43114264 GGTAAGAAGGCAGACCAGGCCGG + Intergenic
1053943721 9:43280655-43280677 GGTAGAAGGCCAGCACAGGTTGG + Intergenic
1054282621 9:63139006-63139028 GGTAAGAAGGCAGACCAGGCTGG - Intergenic
1054294178 9:63321443-63321465 GGTAAGAAGGCAGACCAGGCCGG + Intergenic
1054426847 9:65131143-65131165 GGTAAGAAGGCAGACCAGGCCGG + Intergenic
1054503528 9:65890397-65890419 GGTAAGAAGGCAGACCAGGCCGG - Intronic
1054970149 9:71076627-71076649 GGGAGAAAGGCAGCTGAGTTGGG + Intronic
1056326153 9:85480492-85480514 GCGAGCCAGGCAGCCCAGGTGGG - Intergenic
1056335485 9:85564210-85564232 GGTGGAACGGCAGCCCCAGTGGG + Intronic
1057884506 9:98819724-98819746 GGTAGGAGGGAAGGCCAGGTGGG + Intronic
1059540725 9:115127759-115127781 GATGGAAAGACAGGCCAGGTTGG + Intergenic
1060656727 9:125377077-125377099 AAAAGAAAGGCAGCCCGGGTTGG + Intergenic
1060748251 9:126151891-126151913 GGTGGAGAGGCAGCTCAGGGAGG - Intergenic
1061131973 9:128713431-128713453 GGGTGGAAGGCTGCCCAGGTCGG + Intronic
1061403802 9:130382800-130382822 GGGAGAAAGGCAGCCCATTCTGG - Intronic
1062463392 9:136671136-136671158 GGTAGGCAGGCAGTCCAGGGTGG + Intronic
1062528375 9:136987864-136987886 GGGAGAAGGGCAGTCCAGGCAGG - Intergenic
1203586839 Un_KI270747v1:10558-10580 GGTAGAAGGCCAGCACAGGTTGG + Intergenic
1189106183 X:38238088-38238110 AGGAGAAGGGCACCCCAGGTAGG - Intronic
1189712896 X:43832995-43833017 AGAAGAAAGGCGGGCCAGGTGGG + Intronic
1190056152 X:47182042-47182064 GGTAATAGGGCAGCCCAGGGAGG + Exonic
1192306976 X:69971545-69971567 GGTAAAAAGGCAGTCAAGGAGGG - Intronic
1196609002 X:117689555-117689577 GGGAGAAAAGCTGCCCAGTTGGG - Intergenic