ID: 1067009906

View in Genome Browser
Species Human (GRCh38)
Location 10:42701234-42701256
Sequence ATCTATAAGCAAGTCCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067009906_1067009910 -3 Left 1067009906 10:42701234-42701256 CCCAACAGGACTTGCTTATAGAT No data
Right 1067009910 10:42701254-42701276 GATGCCATATAGGGTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067009906 Original CRISPR ATCTATAAGCAAGTCCTGTT GGG (reversed) Intergenic
No off target data available for this crispr