ID: 1067014077

View in Genome Browser
Species Human (GRCh38)
Location 10:42742736-42742758
Sequence CTGAAAACACTGATATAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067014077_1067014082 16 Left 1067014077 10:42742736-42742758 CCCTCCTATATCAGTGTTTTCAG No data
Right 1067014082 10:42742775-42742797 TTGTGTTTCTGACTTTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067014077 Original CRISPR CTGAAAACACTGATATAGGA GGG (reversed) Intergenic
No off target data available for this crispr