ID: 1067014185

View in Genome Browser
Species Human (GRCh38)
Location 10:42744008-42744030
Sequence ACCCTTATTTTATTTAGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067014184_1067014185 11 Left 1067014184 10:42743974-42743996 CCTAGCTTAGTGTAGCAGTGTTT No data
Right 1067014185 10:42744008-42744030 ACCCTTATTTTATTTAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067014185 Original CRISPR ACCCTTATTTTATTTAGTAA TGG Intergenic