ID: 1067015222

View in Genome Browser
Species Human (GRCh38)
Location 10:42753290-42753312
Sequence CGCCGGCGGCGCCTTTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067015222_1067015229 6 Left 1067015222 10:42753290-42753312 CCCAGGCAAAGGCGCCGCCGGCG No data
Right 1067015229 10:42753319-42753341 GCGCGGCCTCCTCCTCCAGGCGG No data
1067015222_1067015228 3 Left 1067015222 10:42753290-42753312 CCCAGGCAAAGGCGCCGCCGGCG No data
Right 1067015228 10:42753316-42753338 CCAGCGCGGCCTCCTCCTCCAGG No data
1067015222_1067015234 23 Left 1067015222 10:42753290-42753312 CCCAGGCAAAGGCGCCGCCGGCG No data
Right 1067015234 10:42753336-42753358 AGGCGGCGCTTGTGAGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067015222 Original CRISPR CGCCGGCGGCGCCTTTGCCT GGG (reversed) Intergenic
No off target data available for this crispr