ID: 1067015350

View in Genome Browser
Species Human (GRCh38)
Location 10:42753852-42753874
Sequence CCGCCCGGTCCCGTGAGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067015341_1067015350 7 Left 1067015341 10:42753822-42753844 CCAGGCGTGAGCTCCAGAACCCG No data
Right 1067015350 10:42753852-42753874 CCGCCCGGTCCCGTGAGCGCGGG No data
1067015338_1067015350 19 Left 1067015338 10:42753810-42753832 CCTCCGCCGACGCCAGGCGTGAG No data
Right 1067015350 10:42753852-42753874 CCGCCCGGTCCCGTGAGCGCGGG No data
1067015342_1067015350 -6 Left 1067015342 10:42753835-42753857 CCAGAACCCGCTCCCAACCGCCC No data
Right 1067015350 10:42753852-42753874 CCGCCCGGTCCCGTGAGCGCGGG No data
1067015340_1067015350 13 Left 1067015340 10:42753816-42753838 CCGACGCCAGGCGTGAGCTCCAG No data
Right 1067015350 10:42753852-42753874 CCGCCCGGTCCCGTGAGCGCGGG No data
1067015339_1067015350 16 Left 1067015339 10:42753813-42753835 CCGCCGACGCCAGGCGTGAGCTC No data
Right 1067015350 10:42753852-42753874 CCGCCCGGTCCCGTGAGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067015350 Original CRISPR CCGCCCGGTCCCGTGAGCGC GGG Intergenic