ID: 1067016560

View in Genome Browser
Species Human (GRCh38)
Location 10:42760222-42760244
Sequence CTTTGTGACCAGAGCCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067016560_1067016561 -10 Left 1067016560 10:42760222-42760244 CCAACTGGGCTCTGGTCACAAAG No data
Right 1067016561 10:42760235-42760257 GGTCACAAAGCACCCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067016560 Original CRISPR CTTTGTGACCAGAGCCCAGT TGG (reversed) Intergenic
No off target data available for this crispr