ID: 1067019828

View in Genome Browser
Species Human (GRCh38)
Location 10:42785573-42785595
Sequence GTGCTCTTTCCAACTTTTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 2, 1: 0, 2: 0, 3: 30, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067019828_1067019831 11 Left 1067019828 10:42785573-42785595 CCTCCAAAAGTTGGAAAGAGCAC 0: 2
1: 0
2: 0
3: 30
4: 272
Right 1067019831 10:42785607-42785629 GCCTCATTCGGAACTTTACCCGG 0: 1
1: 4
2: 0
3: 4
4: 31
1067019828_1067019830 -1 Left 1067019828 10:42785573-42785595 CCTCCAAAAGTTGGAAAGAGCAC 0: 2
1: 0
2: 0
3: 30
4: 272
Right 1067019830 10:42785595-42785617 CTTTGATACAATGCCTCATTCGG 0: 2
1: 4
2: 1
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067019828 Original CRISPR GTGCTCTTTCCAACTTTTGG AGG (reversed) Exonic