ID: 1067019829

View in Genome Browser
Species Human (GRCh38)
Location 10:42785576-42785598
Sequence AAAGTGCTCTTTCCAACTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 923
Summary {0: 2, 1: 0, 2: 2, 3: 21, 4: 898}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067019829_1067019831 8 Left 1067019829 10:42785576-42785598 CCAAAAGTTGGAAAGAGCACTTT 0: 2
1: 0
2: 2
3: 21
4: 898
Right 1067019831 10:42785607-42785629 GCCTCATTCGGAACTTTACCCGG 0: 1
1: 4
2: 0
3: 4
4: 31
1067019829_1067019830 -4 Left 1067019829 10:42785576-42785598 CCAAAAGTTGGAAAGAGCACTTT 0: 2
1: 0
2: 2
3: 21
4: 898
Right 1067019830 10:42785595-42785617 CTTTGATACAATGCCTCATTCGG 0: 2
1: 4
2: 1
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067019829 Original CRISPR AAAGTGCTCTTTCCAACTTT TGG (reversed) Exonic