ID: 1067019830

View in Genome Browser
Species Human (GRCh38)
Location 10:42785595-42785617
Sequence CTTTGATACAATGCCTCATT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 2, 1: 4, 2: 1, 3: 10, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067019825_1067019830 23 Left 1067019825 10:42785549-42785571 CCAATAGTGGTAGTGGTGATGGG 0: 2
1: 1
2: 7
3: 29
4: 138
Right 1067019830 10:42785595-42785617 CTTTGATACAATGCCTCATTCGG 0: 2
1: 4
2: 1
3: 10
4: 118
1067019822_1067019830 27 Left 1067019822 10:42785545-42785567 CCCACCAATAGTGGTAGTGGTGA 0: 3
1: 0
2: 0
3: 1
4: 55
Right 1067019830 10:42785595-42785617 CTTTGATACAATGCCTCATTCGG 0: 2
1: 4
2: 1
3: 10
4: 118
1067019829_1067019830 -4 Left 1067019829 10:42785576-42785598 CCAAAAGTTGGAAAGAGCACTTT 0: 2
1: 0
2: 2
3: 21
4: 898
Right 1067019830 10:42785595-42785617 CTTTGATACAATGCCTCATTCGG 0: 2
1: 4
2: 1
3: 10
4: 118
1067019828_1067019830 -1 Left 1067019828 10:42785573-42785595 CCTCCAAAAGTTGGAAAGAGCAC 0: 2
1: 0
2: 0
3: 30
4: 272
Right 1067019830 10:42785595-42785617 CTTTGATACAATGCCTCATTCGG 0: 2
1: 4
2: 1
3: 10
4: 118
1067019820_1067019830 29 Left 1067019820 10:42785543-42785565 CCCCCACCAATAGTGGTAGTGGT 0: 3
1: 2
2: 1
3: 8
4: 61
Right 1067019830 10:42785595-42785617 CTTTGATACAATGCCTCATTCGG 0: 2
1: 4
2: 1
3: 10
4: 118
1067019821_1067019830 28 Left 1067019821 10:42785544-42785566 CCCCACCAATAGTGGTAGTGGTG 0: 3
1: 0
2: 0
3: 6
4: 79
Right 1067019830 10:42785595-42785617 CTTTGATACAATGCCTCATTCGG 0: 2
1: 4
2: 1
3: 10
4: 118
1067019823_1067019830 26 Left 1067019823 10:42785546-42785568 CCACCAATAGTGGTAGTGGTGAT 0: 2
1: 1
2: 3
3: 10
4: 91
Right 1067019830 10:42785595-42785617 CTTTGATACAATGCCTCATTCGG 0: 2
1: 4
2: 1
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067019830 Original CRISPR CTTTGATACAATGCCTCATT CGG Exonic