ID: 1067019831

View in Genome Browser
Species Human (GRCh38)
Location 10:42785607-42785629
Sequence GCCTCATTCGGAACTTTACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 4, 2: 0, 3: 4, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067019828_1067019831 11 Left 1067019828 10:42785573-42785595 CCTCCAAAAGTTGGAAAGAGCAC 0: 2
1: 0
2: 0
3: 30
4: 272
Right 1067019831 10:42785607-42785629 GCCTCATTCGGAACTTTACCCGG 0: 1
1: 4
2: 0
3: 4
4: 31
1067019829_1067019831 8 Left 1067019829 10:42785576-42785598 CCAAAAGTTGGAAAGAGCACTTT 0: 2
1: 0
2: 2
3: 21
4: 898
Right 1067019831 10:42785607-42785629 GCCTCATTCGGAACTTTACCCGG 0: 1
1: 4
2: 0
3: 4
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067019831 Original CRISPR GCCTCATTCGGAACTTTACC CGG Exonic