ID: 1067022465

View in Genome Browser
Species Human (GRCh38)
Location 10:42813252-42813274
Sequence GGTCTAAATAAACCAAAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067022465_1067022466 -9 Left 1067022465 10:42813252-42813274 CCGTCTTTTGGTTTATTTAGACC 0: 1
1: 0
2: 3
3: 14
4: 330
Right 1067022466 10:42813266-42813288 ATTTAGACCATTTACATTTAAGG 0: 44
1: 3860
2: 2786
3: 1801
4: 1551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067022465 Original CRISPR GGTCTAAATAAACCAAAAGA CGG (reversed) Intronic
900327885 1:2119020-2119042 CATCTGATTAAACCAAAAGAAGG - Intronic
900721921 1:4182100-4182122 GGTGTAAGTAAACAAGAAGAGGG + Intergenic
900841411 1:5051490-5051512 GGTATAAGTAAACAAGAAGAGGG - Intergenic
906063924 1:42966474-42966496 GGTCTTAAAAAAAAAAAAGAGGG - Intergenic
907686632 1:56618184-56618206 GGTCTGAAATAACCAAATGATGG + Intronic
907882828 1:58567003-58567025 GGTATAAATAGACCATAAGCAGG - Intergenic
907898588 1:58716859-58716881 AGTCAGAATAAACAAAAAGATGG - Intergenic
907990717 1:59579684-59579706 TGTGTCAATAAACCAAGAGAGGG - Intronic
909614406 1:77590370-77590392 CGTCTCAAAAAACAAAAAGAGGG + Intronic
910031353 1:82728531-82728553 CTTCAAAATAAACCAGAAGATGG - Intergenic
910913802 1:92267160-92267182 GGGCAAAATAAACCATAGGAGGG + Intronic
911790393 1:102008060-102008082 TGTCTAAGTAATCCAATAGATGG - Intergenic
911967572 1:104387023-104387045 GGTATAAGTAAACAAGAAGAGGG - Intergenic
913577178 1:120188024-120188046 GGTCTAATTAAAAAAAAATAAGG + Intergenic
914460827 1:147883332-147883354 TGTATAAATAAACCAATACAAGG - Intergenic
914559091 1:148799459-148799481 GGTCTAATTAAAAAAAAATAAGG + Intergenic
914613742 1:149330770-149330792 GGTCTAATTAAAAAAAAATAAGG - Intergenic
915922227 1:159985017-159985039 GGTACAACTAAACCAAGAGAGGG + Intergenic
918804012 1:189015828-189015850 GGACTGAATAAAGCAAATGAGGG - Intergenic
920413778 1:205783840-205783862 GGTATAAACACACCTAAAGAAGG + Intergenic
920667592 1:207975298-207975320 TATCTAAGTAACCCAAAAGAAGG + Intergenic
920918920 1:210281758-210281780 GGTATAAATAAACCACACAATGG - Intergenic
920927007 1:210351256-210351278 GGTCTAAATAGAACAAAAGGAGG - Intronic
921520620 1:216151054-216151076 GGTATAAGTAAACAAGAAGAGGG - Intronic
921761314 1:218918459-218918481 GGTATAATTAAACAAAAAGGAGG + Intergenic
922411569 1:225381011-225381033 GGTTAAAAAAAATCAAAAGAAGG + Intronic
923942970 1:238849699-238849721 GGATTAAATAAGACAAAAGAAGG - Intergenic
1063579981 10:7297489-7297511 GAGCTAAATAAAGGAAAAGAGGG + Intronic
1064224108 10:13467361-13467383 GGTTTAAATAAACCTAATAACGG - Intronic
1064351417 10:14580885-14580907 GCTCTCAATAAGCCAACAGAAGG - Intronic
1065610833 10:27469345-27469367 GGTATAAATAAACAACAAGAGGG - Intergenic
1065839425 10:29689024-29689046 AGTGCAAATAAACTAAAAGAAGG + Intronic
1066348125 10:34609542-34609564 TCTCTAAACAAACAAAAAGAGGG - Intronic
1067022465 10:42813252-42813274 GGTCTAAATAAACCAAAAGACGG - Intronic
1067825717 10:49571277-49571299 GGTCTAAACAAACCCAAACCAGG + Intergenic
1069190617 10:65483640-65483662 GGTCAAAATAAACCGACAAAGGG - Intergenic
1071472901 10:85997626-85997648 TGTTTTAATAACCCAAAAGAAGG + Intronic
1072124790 10:92436053-92436075 AGTTTTAATAAACGAAAAGATGG - Intergenic
1072298989 10:94040820-94040842 GGTTGAAAAAAATCAAAAGAAGG + Intronic
1073709084 10:106018335-106018357 GGTATAAGTAAACAAGAAGAGGG + Intergenic
1074678437 10:115879496-115879518 TTTCTTTATAAACCAAAAGATGG + Intronic
1076775370 10:132693346-132693368 GGTCTAAATATACCAATTAAAGG + Intronic
1078742301 11:14078342-14078364 TCTCTACAAAAACCAAAAGAAGG - Intronic
1080748885 11:35134573-35134595 AGTCTAAATAAACCAGTAGCTGG - Intergenic
1081176220 11:39930577-39930599 GGTCAAGATAAGCCAATAGAAGG - Intergenic
1082946656 11:58768676-58768698 GGCAGAAATAAACAAAAAGAGGG + Intergenic
1085005307 11:73082945-73082967 GGTCTAAGTAAAATTAAAGAAGG + Intronic
1086320947 11:85647198-85647220 GGACTAATTAACCCAATAGAAGG - Intergenic
1086381219 11:86256783-86256805 GCTCTAAATGAACAATAAGAGGG + Intronic
1087601502 11:100322224-100322246 CGTCTAAAAAAAAAAAAAGACGG - Intronic
1089047583 11:115516486-115516508 GGTGTAAAGAAACAAAAAGAAGG - Intergenic
1089953992 11:122553998-122554020 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1090059727 11:123453818-123453840 GGACAAAGTAAACCCAAAGAGGG + Intergenic
1090373914 11:126275932-126275954 GGTCAAAGAAAACCAAAACAAGG - Intronic
1090575412 11:128096770-128096792 GGACTGAATAGAACAAAAGAGGG + Intergenic
1092001882 12:5039500-5039522 GGTCAAAATAAACCATACTAAGG - Intergenic
1092580452 12:9835480-9835502 GGTATAAGTAAACAAGAAGAGGG + Intronic
1092592368 12:9963963-9963985 GGTATAAGTAAACAACAAGAGGG + Intronic
1093070446 12:14702656-14702678 GGTCTAAAAAAAAAAAAAAAAGG + Intergenic
1093296445 12:17397904-17397926 AGTCAAAATAAACTAAAACAGGG + Intergenic
1093359121 12:18202069-18202091 GGTTTAAGTAAACAAGAAGAGGG - Intronic
1093951470 12:25167966-25167988 GGTATAAGTAAACAAGAAGAGGG - Intronic
1094723524 12:33089416-33089438 GGTACAAATAAACAACAAGAGGG + Intergenic
1094784217 12:33827307-33827329 TTACTAAATAAACCAAAACAAGG + Intergenic
1094826411 12:34272603-34272625 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1095526546 12:43132828-43132850 GGACAAAATAAACCAGAAAATGG - Intergenic
1097572536 12:61352646-61352668 AGTCTAAATAAACAAAAGAAAGG - Intergenic
1098621305 12:72602961-72602983 GGTAGAAAAATACCAAAAGAAGG + Intronic
1099485294 12:83222531-83222553 GGCCTGAATAGAACAAAAGATGG - Intergenic
1101443190 12:104718861-104718883 GGTCTAAATTAAACAAGACAAGG + Intronic
1101498224 12:105276413-105276435 GGTGTAAATAAAAGGAAAGATGG - Intronic
1103482249 12:121258334-121258356 TGTCTCAATAAAACAAAAAAAGG - Intronic
1103652328 12:122442540-122442562 GACCTAAATAAATGAAAAGACGG - Intergenic
1105032658 12:132894954-132894976 GGTATAAGTAAACAAGAAGAGGG - Intronic
1106756681 13:32829038-32829060 AGTCTGAATAAACCGAAGGATGG + Intergenic
1106934277 13:34701289-34701311 GGTGTAACTAAACTAAAAGGAGG + Intergenic
1107387414 13:39926871-39926893 GGTATAAATAATCCAAATAAAGG + Intergenic
1107602564 13:42028468-42028490 GGTCAAAAGAAATCAAATGAAGG + Intergenic
1108003795 13:45927702-45927724 GGCCTAAAGAGACCAAAAGGTGG + Intergenic
1108128917 13:47275928-47275950 GGTATAAATAAATCAAGAAAAGG - Intergenic
1109548843 13:63865378-63865400 GGATTAAATACAACAAAAGAGGG + Intergenic
1109775216 13:67031898-67031920 GGTCTAAATAAAAGACCAGAAGG - Intronic
1109845546 13:67985541-67985563 GCACTAAATAGACCATAAGAAGG + Intergenic
1110187309 13:72690534-72690556 GGCCTGAAAAAAACAAAAGATGG - Intergenic
1111518915 13:89373703-89373725 GCTCTAAGTAACTCAAAAGAAGG + Intergenic
1112250898 13:97779425-97779447 GGTCTAAAAAAAGACAAAGAGGG - Intergenic
1112936176 13:104802241-104802263 GTTTTAAATATCCCAAAAGAAGG + Intergenic
1113993564 14:16048909-16048931 GTTCAAAATAAACCAAAAACTGG - Intergenic
1114315942 14:21510194-21510216 GGTCTAATTAGACAAAAATAAGG - Intronic
1115120737 14:29933775-29933797 GCTCAAAATAAATGAAAAGATGG + Intronic
1116530430 14:45966075-45966097 GGTCTGAACAGAACAAAAGATGG - Intergenic
1117225929 14:53659017-53659039 GGTCCAAATAAATGAAAAAAAGG + Intergenic
1118936658 14:70295016-70295038 GGTATAAGTAAACAAGAAGAGGG + Intergenic
1120114784 14:80602469-80602491 TGTCTAAATAAATTAAAAGGAGG + Intronic
1120376413 14:83713346-83713368 TGTGTAAATGAACCAAGAGATGG - Intergenic
1121090011 14:91174701-91174723 GGTATAATCAAACCCAAAGAGGG + Intronic
1121389339 14:93560977-93560999 GGTATAAGTAAACAAGAAGAGGG + Intronic
1121935003 14:98010366-98010388 AGTCAAAATAATCTAAAAGAAGG + Intergenic
1122041554 14:98991307-98991329 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1122858072 14:104569426-104569448 GCTCTAAATAAACCCCAAAAAGG + Intronic
1125100947 15:35911816-35911838 GGTCTAGATACATGAAAAGAGGG + Intergenic
1125791296 15:42367966-42367988 GATCTGAATTAACTAAAAGAGGG - Intronic
1126852687 15:52806517-52806539 GGTCAAAATAGCCCAACAGAAGG - Intergenic
1127336293 15:57988365-57988387 TATCTAACTCAACCAAAAGAAGG + Intronic
1127514944 15:59684423-59684445 GGGAAAAATAAACAAAAAGAGGG + Intronic
1128158045 15:65404096-65404118 GGTCTAAAAAAATCTAAACATGG + Intronic
1130027641 15:80283528-80283550 GGCCTGAATAGAACAAAAGACGG + Intergenic
1130415005 15:83685192-83685214 TGTACAAATAAACTAAAAGAAGG - Intronic
1130570564 15:85039423-85039445 TGTCTAAAAAAAAAAAAAGATGG + Intronic
1131702402 15:94952562-94952584 TGTCAAAGTAAACCAAAAAATGG - Intergenic
1132172411 15:99674371-99674393 GCTGTAAATAAAGAAAAAGAAGG - Exonic
1133390507 16:5406326-5406348 GGTCTGAATAGAACAAAAGGTGG + Intergenic
1133614507 16:7463498-7463520 GGTCTCAAAAAAACAAAAAAAGG + Intronic
1133810379 16:9156951-9156973 AGTCTAAAAAAAAAAAAAGAGGG - Intergenic
1134468767 16:14503021-14503043 GGTTTAAATAAAACATAAGACGG + Intronic
1138758447 16:59516550-59516572 GGTATAAGTAAACAAGAAGAGGG + Intergenic
1141283329 16:82648587-82648609 CCTCTAAATAAAGAAAAAGAAGG + Intronic
1143496199 17:7314053-7314075 GGACTAAAGAAACCACCAGATGG - Intronic
1146077290 17:29742933-29742955 TGTCTCAAAAAATCAAAAGAAGG - Intronic
1146726535 17:35160972-35160994 GGTCTATAAAAACCAAACAAGGG - Intronic
1147477901 17:40730951-40730973 GTTCTCAATCATCCAAAAGAAGG - Intergenic
1148376983 17:47156961-47156983 GTTCAAAATAAACCAAAAACTGG - Exonic
1148544722 17:48508874-48508896 TATCTAAATAAACCAGAGGAAGG + Intergenic
1148995133 17:51702847-51702869 GGTCTAAAGAGACAAAAGGAAGG - Intronic
1150884494 17:69069709-69069731 GATCAGAATAAAACAAAAGAAGG - Intergenic
1156237804 18:35220965-35220987 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1156598162 18:38571931-38571953 GTTTTAAATAAACCAAGACATGG + Intergenic
1156759504 18:40570393-40570415 GGTCTTCATAAAGCAAAACAAGG + Intergenic
1156774727 18:40772977-40772999 GGTAGAAATAAACGCAAAGAGGG + Intergenic
1157984597 18:52422805-52422827 GGTATAAGTGAACCCAAAGAAGG + Intronic
1158280021 18:55814327-55814349 TGTCTAAAAAAAAAAAAAGAGGG - Intergenic
1158303809 18:56082774-56082796 GCTCAAAATAAACCAAATGAGGG - Intergenic
1158986240 18:62820185-62820207 AGTATAAATAAATCAAAAGCTGG + Intronic
1159488114 18:69093046-69093068 GTTTTGAATAAACAAAAAGATGG + Intergenic
1159517641 18:69477851-69477873 GGTTTCAATAAACCAAATGTAGG - Intronic
1159793367 18:72811861-72811883 GGTCTCCAAGAACCAAAAGAAGG - Intronic
1163857851 19:19719771-19719793 GGTCTAAATACAACAAATGGTGG + Intronic
1163899510 19:20089270-20089292 GGTATAAGTAAACGAGAAGAGGG + Intronic
1166396967 19:42448523-42448545 GGTATAAGCAAACAAAAAGAGGG + Intergenic
1166537617 19:43584848-43584870 TGTCTAAAAAAATAAAAAGAAGG - Exonic
1166767076 19:45257987-45258009 GGTCTAAAAAAAAAAAAAAAAGG - Intronic
1167150193 19:47704214-47704236 GGACTAGATAAACCAAGAAAAGG + Intergenic
926372479 2:12193931-12193953 ATTCTAAAAAAAACAAAAGATGG + Intergenic
926985080 2:18613644-18613666 GGTCTGAATAGACCAAAAAGGGG + Intergenic
928621712 2:33095707-33095729 GATCTTAATGAAACAAAAGATGG + Intronic
928770439 2:34697991-34698013 GGTATAAGTAAACAAGAAGAGGG + Intergenic
928908283 2:36391426-36391448 GTTCTAAAAAAATCAAAAGTGGG - Intronic
930052934 2:47230439-47230461 TGTCTCAAAAAACAAAAAGAAGG + Intergenic
930256129 2:49094084-49094106 TATTTAAATAATCCAAAAGAAGG - Intronic
932152956 2:69389573-69389595 GGTCTAATTCAAACAAATGAGGG + Intergenic
933671376 2:85010766-85010788 GGAATAAATAAATCAGAAGAAGG - Intronic
933946523 2:87290843-87290865 CACCTAAAAAAACCAAAAGAGGG + Intergenic
935381554 2:102456238-102456260 TGTTTAAATAATCCAAAAGAAGG + Intergenic
935536068 2:104296074-104296096 GGTCCAAATAAAGAGAAAGAGGG - Intergenic
936333670 2:111570698-111570720 CACCTAAAAAAACCAAAAGAGGG - Intergenic
937327241 2:120997784-120997806 TGTTCAAATAACCCAAAAGAGGG + Intergenic
937415587 2:121712043-121712065 TGTCTCAAAAAACAAAAAGAAGG - Intergenic
937420430 2:121750252-121750274 GGTTTAAATATACCAATTGAAGG + Intronic
938538115 2:132261959-132261981 GTTCAAAATAAACCAAAAACTGG + Intergenic
940304355 2:152209766-152209788 AGTCTAAATAAAGCAAAATCTGG - Intergenic
940895604 2:159079878-159079900 TGTCTAAACAAACAAAAATAGGG - Intronic
941455506 2:165709163-165709185 GGTATAAGTAAACAAGAAGAGGG + Intergenic
941472471 2:165905222-165905244 GGTATAAATAACACAATAGAGGG + Intronic
942175666 2:173332063-173332085 GGTCTAAATATACCAACTAAAGG - Intergenic
943307778 2:186287378-186287400 AGTTCAAAAAAACCAAAAGATGG - Intergenic
943412307 2:187559521-187559543 GGTATAAGTAAACAAGAAGAGGG + Intronic
943731457 2:191307227-191307249 GGTCTAAAAAAAAAAACAGAAGG - Intronic
943865777 2:192923272-192923294 GGTATAAGTAAACAAGAAGAGGG - Intergenic
944251805 2:197586206-197586228 GGTATAAGTAAACAAGAAGAGGG - Intronic
945127621 2:206530130-206530152 GGTTGAAAAAAATCAAAAGAAGG + Intronic
946566760 2:220974122-220974144 GGTAGAAAGAAAACAAAAGAAGG + Intergenic
948402905 2:237697025-237697047 TGTCTCAATAAAAAAAAAGAAGG - Intronic
1168739709 20:177244-177266 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1168889372 20:1284405-1284427 GGACTAAATAAAGCATAAAATGG + Intronic
1171339169 20:24413615-24413637 GGTCTAAATCATCCAGAAGCTGG + Intergenic
1171811466 20:29746950-29746972 GTTCAAAATAAACCAAAAACTGG + Intergenic
1171867021 20:30493744-30493766 GTTCAAAATAAACCAAAAACTGG + Intergenic
1172917808 20:38456718-38456740 GGTCTGAACAAAGCAAATGAAGG + Intergenic
1173411441 20:42813954-42813976 GGTATAAACAAAGCAAAGGAAGG - Intronic
1173756643 20:45522451-45522473 GACCTGAATAAAGCAAAAGATGG - Intergenic
1173991130 20:47304519-47304541 GGTCTACATAAACCAGAGTATGG + Intronic
1175736852 20:61393148-61393170 GCTCTGTATAAACCAAATGAAGG - Intronic
1176613046 21:9003606-9003628 GTACTAAATAAAACAAAATATGG - Intergenic
1176712132 21:10160202-10160224 GTACTAAATAAAACAAAATATGG + Intergenic
1177593183 21:23200683-23200705 GGTAGAAATAGACAAAAAGATGG + Intergenic
1177957895 21:27623591-27623613 GGCCTGAATAAAGCAAAAGGTGG + Intergenic
1179280676 21:39931351-39931373 GGTCTCATAAAACCAGAAGAAGG + Intergenic
1180313704 22:11258604-11258626 GTTCAAAATAAACCAAAAACTGG + Intergenic
1184214113 22:43055024-43055046 TGTCTCAAAAAACAAAAAGAAGG - Intronic
950401751 3:12774340-12774362 GGTCTAACAGAACCAAAAGGTGG - Intergenic
950760326 3:15217242-15217264 TGTCTAAAAAAAAAAAAAGAAGG + Intronic
950767990 3:15288150-15288172 GGTCTGAATAGAGCAAAAGAGGG - Intronic
952506685 3:34013468-34013490 GTTCTAAATAAGCCAAGCGATGG - Intergenic
956296548 3:67721003-67721025 GGTCTAAATACAGCAAATAAAGG - Intergenic
957461648 3:80529226-80529248 GGTCAAGATAAACCACAAGAGGG + Intergenic
957480612 3:80788735-80788757 GGCCTAAATAGAACAAAAGGTGG + Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959508870 3:107186801-107186823 TGTTCAAATAACCCAAAAGAAGG + Intergenic
959561683 3:107789602-107789624 GGTTTAAATAAGCCTAAAAAGGG + Intronic
959575224 3:107926432-107926454 GATGGAAATAAACCAGAAGAAGG - Intergenic
962983762 3:140515308-140515330 AGACTAATTAAACCAAAAGCTGG - Intronic
963556581 3:146796624-146796646 GGTAAATATTAACCAAAAGATGG - Intergenic
965286258 3:166824144-166824166 GGTATAAGTAAACAAGAAGAGGG + Intergenic
965625839 3:170683386-170683408 GGTATAAGTAAACAAGAAGAGGG + Intronic
966161578 3:176974287-176974309 GGTGTAAACAAACCAACCGATGG - Intergenic
966272616 3:178125944-178125966 GATTTAAATTAACAAAAAGAAGG + Intergenic
966279769 3:178213106-178213128 GGTATAAGTAAACAAGAAGAAGG - Intergenic
966658289 3:182384305-182384327 GGACTTGGTAAACCAAAAGAAGG + Intergenic
967639524 3:191844720-191844742 GGTATGAATTAACCAAAATAGGG - Intergenic
970821764 4:20224680-20224702 GGGCTAAATAAACCAAATGATGG + Intergenic
971134989 4:23858619-23858641 GGTCTTCAAAAACCAAATGAGGG - Intronic
971221433 4:24710791-24710813 TGTTTAAGTAATCCAAAAGAAGG - Intergenic
971565599 4:28136538-28136560 TGTCTAAATACACCAAAAATGGG - Intergenic
971737778 4:30478983-30479005 GGTATAAATAAAACAAATGTTGG + Intergenic
971814745 4:31472819-31472841 GTTCTTAATAAAACAAAACATGG + Intergenic
974045593 4:56895801-56895823 TGTCTCAAAAAACCAAAAAAAGG - Intergenic
974756117 4:66210303-66210325 GTTATAAAGAAACCAAAGGAAGG + Intergenic
974764170 4:66319749-66319771 GGTGCAAAAAAAGCAAAAGATGG - Intergenic
976310897 4:83612335-83612357 CGTCTAAAAAAAAAAAAAGAAGG - Intergenic
976423487 4:84872652-84872674 GGTCTAAATACACCAATTAAAGG + Intronic
977042237 4:92029536-92029558 GGTATAAGTAAACAAGAAGAGGG - Intergenic
978651102 4:111006229-111006251 GGTCCACATAAACCAACAGGCGG - Intergenic
978743915 4:112170111-112170133 GTTATAGAGAAACCAAAAGAAGG - Intronic
979756052 4:124340445-124340467 GGGTTAAAGAAACCAAAAGAAGG - Intergenic
981159145 4:141476141-141476163 TGTATCAATAAAGCAAAAGAGGG - Intergenic
981159892 4:141485270-141485292 CGTCTAAAAAAAAAAAAAGAAGG - Intergenic
981480454 4:145233272-145233294 GGTCTCAAAAAAAAAAAAGAGGG + Intergenic
982064989 4:151646479-151646501 GGACTAACTAAACCATAACAGGG - Intronic
983180134 4:164638239-164638261 GGTCTCTATAAACCAACAGCAGG - Intergenic
983480362 4:168265997-168266019 ATTCTAAATAAACCTAAATATGG - Intronic
984164964 4:176295755-176295777 GGTATAAGTAAACAAGAAGAGGG + Intergenic
987615248 5:20265950-20265972 GATCTAAATAAACCAAAAAAGGG + Intronic
987989894 5:25197498-25197520 AGTCTTAAAAAAGCAAAAGAAGG - Intergenic
990805244 5:59653534-59653556 GGTATAAATAAACAATAAGCAGG + Intronic
993030286 5:82697678-82697700 GGTCATAATAAACCTAAAGTTGG - Intergenic
994346727 5:98696492-98696514 GGTCTGAATATACCTGAAGAAGG + Intergenic
994810463 5:104511618-104511640 GATCTATAGAAACCAAAATATGG + Intergenic
995124762 5:108569193-108569215 GGTATAAGTAAACAAGAAGAGGG + Intergenic
996358076 5:122618483-122618505 GGTATAAGTAAACAAGAAGAGGG + Intergenic
998580549 5:143370343-143370365 GTCCTAAATAAACAAAAAGTAGG - Intronic
999162331 5:149512654-149512676 TGTCCTAATAAACCAAAAGTGGG - Intronic
1001508829 5:172302867-172302889 GATCAAAATAAAACAAAATACGG + Intergenic
1001738662 5:174030200-174030222 TATTTAAATAATCCAAAAGAAGG + Intergenic
1002113091 5:176934104-176934126 GGCCTAAAAGACCCAAAAGATGG - Intronic
1003508631 6:6761180-6761202 GGTTTAAATAAATGAAAATAGGG - Intergenic
1004691966 6:17999894-17999916 GGTCTCAATAGAACAAAAAAAGG - Intergenic
1004941648 6:20564361-20564383 TTCCTAAATATACCAAAAGATGG + Intronic
1005121530 6:22394903-22394925 GTTCTAAATAAACCAACAGCTGG + Intergenic
1005321199 6:24656070-24656092 AATCAAAATAAACAAAAAGAAGG + Intronic
1005555606 6:26979271-26979293 TGACTAAATTAACAAAAAGAAGG + Intergenic
1005732666 6:28713696-28713718 TGTCTAAAAAAAAAAAAAGAGGG - Intergenic
1006199513 6:32275355-32275377 GGTCTCAATAAACAAATAGGAGG - Intergenic
1006312477 6:33270622-33270644 CGTCTAAAGAAAACAAAAAAAGG + Intronic
1007300296 6:40862943-40862965 GGTATAAGTAAACAAGAAGAGGG + Intergenic
1008002829 6:46378376-46378398 TGTCTAAATCACTCAAAAGATGG + Intronic
1008140170 6:47822900-47822922 GTTCTAGATAATCCAAAAGTGGG + Intronic
1009343862 6:62590173-62590195 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1010115932 6:72311003-72311025 GTTGGAAATAAGCCAAAAGATGG - Intronic
1010586056 6:77659590-77659612 GGTATAAGTAAACGAGAAGAGGG + Intergenic
1010601789 6:77837726-77837748 GATTTAAACAAACCAAAAAATGG + Intronic
1012289744 6:97438270-97438292 GGTCAAAATCATCCAAATGATGG + Intergenic
1012313537 6:97757261-97757283 CGTCTCAAAAAACAAAAAGAAGG - Intergenic
1012448754 6:99332950-99332972 GGTTGAAAAAAATCAAAAGAAGG + Intronic
1012539885 6:100350208-100350230 TGTCTAAATGAATCAAAAGAAGG + Intergenic
1013089849 6:106890407-106890429 AGTATAAATGAACCACAAGATGG - Intergenic
1014289073 6:119537805-119537827 GGTTCAAATAATGCAAAAGATGG - Intergenic
1014880819 6:126722464-126722486 GGTATAATTAAACCCTAAGAAGG - Intergenic
1015426260 6:133071505-133071527 GGTCAACATAAACCAAAAGAAGG - Intergenic
1015565241 6:134563226-134563248 GGTGTAACTAACCCAAGAGAGGG + Intergenic
1016205109 6:141459133-141459155 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1018436758 6:163766730-163766752 TGTCCAAATAAACCAAATGATGG - Intergenic
1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG + Intergenic
1022010475 7:26304231-26304253 GGTCTAAACAAACAAATGGAAGG - Intronic
1022373423 7:29790933-29790955 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1022941792 7:35248973-35248995 GCTTTAAACAAAACAAAAGAGGG - Intronic
1023053963 7:36277044-36277066 GCTCTAAATAAAACAATTGAAGG + Intronic
1023195476 7:37633884-37633906 GGTATAAGTAACCCATAAGAAGG - Intergenic
1026949033 7:74334996-74335018 TGTCTCAAAAAAACAAAAGAGGG + Intronic
1027435655 7:78161848-78161870 CGTTTAAATAAAGGAAAAGATGG + Intronic
1027590643 7:80114535-80114557 GGCCAAAATAAATCAAAGGATGG + Intergenic
1028120332 7:87050146-87050168 GCACAAAATAAACTAAAAGAGGG + Intronic
1030766243 7:113413337-113413359 GGTCTGAATAGAACAAAAGGTGG - Intergenic
1032901503 7:136314801-136314823 TGTTTAAAAAAACAAAAAGAGGG - Intergenic
1032944888 7:136838198-136838220 GGTCTAAATTCACCAAAGGCTGG + Intergenic
1033851345 7:145499294-145499316 GATTTAAATATACCACAAGAGGG - Intergenic
1034084434 7:148310937-148310959 GGTATAAGTAAACAAGAAGAGGG + Intronic
1034744154 7:153507502-153507524 GGTCTCACAAAACCAAAATAGGG - Intergenic
1035010937 7:155714480-155714502 AGTCTGAATAAACACAAAGACGG - Intronic
1037661377 8:20929748-20929770 GGCCTGAACAAATCAAAAGAAGG - Intergenic
1038154638 8:24977245-24977267 GGTAAAAATAACCCAAAAAAAGG - Intergenic
1038689955 8:29752265-29752287 GGACTCAATAAACTAAAAAAAGG + Intergenic
1039344158 8:36685502-36685524 TATTTAGATAAACCAAAAGAAGG - Intergenic
1040836416 8:51736117-51736139 TGTCTAAATAAATTAAGAGAGGG + Intronic
1042900232 8:73718441-73718463 GCACTAAATAAACCAAGAAAGGG + Intronic
1043364060 8:79510812-79510834 GGACTAAGCAATCCAAAAGAGGG + Intergenic
1044387471 8:91606617-91606639 GTTATAAATCAACCAAAACATGG - Intergenic
1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG + Intergenic
1045818673 8:106308286-106308308 GGCCTACATAAACAAAAAGGTGG - Intronic
1047260084 8:123248491-123248513 GGTCACAATCAACCAGAAGAGGG + Exonic
1048175478 8:132148692-132148714 GGCCCAAATAAATCAAAAGGAGG + Intronic
1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG + Intergenic
1048872104 8:138807689-138807711 TGTCTATATAAGACAAAAGATGG - Intronic
1050522780 9:6518844-6518866 GGTCTCAATAAACAAAATGTAGG + Intergenic
1052303462 9:26978934-26978956 GGTATATATAAACCAAACTATGG + Intronic
1052653967 9:31333064-31333086 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1052989436 9:34510545-34510567 GGTAGGAATAAAGCAAAAGAGGG - Intronic
1053593699 9:39537903-39537925 TCTTTAAATAAACAAAAAGATGG + Intergenic
1053649125 9:40145918-40145940 GTACTAAATAAAACAAAATATGG + Intergenic
1053756618 9:41317966-41317988 GTACTAAATAAAACAAAATATGG - Intergenic
1053851485 9:42292954-42292976 TCTTTAAATAAACAAAAAGATGG + Intergenic
1054535456 9:66230255-66230277 GTACTAAATAAAACAAAATATGG - Intergenic
1054572607 9:66827363-66827385 TCTTTAAATAAACAAAAAGATGG - Intergenic
1055286797 9:74737488-74737510 TGTTTAAACAAACCATAAGATGG + Intronic
1055347332 9:75352674-75352696 GGTATAAGTAAACAAGAAGAGGG + Intergenic
1055435838 9:76291262-76291284 AGTCTGAAAAAACCAGAAGAGGG + Intronic
1055840506 9:80497431-80497453 GGTCTAAATAAACATTAAGGAGG - Intergenic
1056269772 9:84935864-84935886 GGTCTCATTTAACCAAAAGGGGG - Intronic
1056324527 9:85465339-85465361 GGTATAAGTAAACAAGAAGAGGG - Intergenic
1058216003 9:102234235-102234257 GACCTCAATAAACCAAAAAAGGG + Intergenic
1061469417 9:130811951-130811973 TCTTTAAATAATCCAAAAGATGG + Intronic
1202796887 9_KI270719v1_random:129191-129213 GTACTAAATAAAACAAAATATGG + Intergenic
1203362094 Un_KI270442v1:224816-224838 GTTCAAAATAAACCAAAAACTGG + Intergenic
1185712994 X:2319091-2319113 GGTTAAAAAAAATCAAAAGAAGG + Intronic
1187022467 X:15398475-15398497 GGATTAGATAAACCACAAGAGGG + Intronic
1187144227 X:16622944-16622966 GGATTAAATAAATCAAAATATGG + Intronic
1187355759 X:18569733-18569755 AGTCTAAAGAAGCAAAAAGAAGG - Intronic
1188205482 X:27351573-27351595 GGTCTAAAAAGGCCAAAAAATGG - Intergenic
1188312508 X:28634696-28634718 GGGGAAAATAAAACAAAAGAAGG - Intronic
1188694225 X:33169595-33169617 AGTGTAAATAAACCAACTGATGG - Intronic
1189506852 X:41619672-41619694 AGTAAAAATAAACCAAAAGGAGG + Intronic
1190156360 X:47996424-47996446 TGTTCAAATAACCCAAAAGAAGG + Intronic
1190378773 X:49817578-49817600 GTTTTAAATAACCCAAAACAAGG + Intergenic
1192112978 X:68383975-68383997 GGGCTAAATAAACGGAAAGTGGG + Intronic
1192245583 X:69369176-69369198 GGTCTAAATAAAAGCAAACAAGG + Intergenic
1192982937 X:76366674-76366696 GGTCACAATAATCCAAAAGATGG + Intergenic
1193082391 X:77418832-77418854 GCACTAAATAGACCACAAGAAGG + Intergenic
1194155084 X:90378340-90378362 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1196525086 X:116721843-116721865 GGTATAAGTAAACAAGAAGAGGG + Intergenic
1198833720 X:140778681-140778703 GGTCAAAATAAATAAAAAAATGG - Intergenic
1199034664 X:143035526-143035548 GGTATAAATTAAACAAAACATGG - Intergenic
1199073674 X:143507249-143507271 GGTATAAATTAAACAAAACATGG + Intergenic
1199092679 X:143710516-143710538 GGTATAAATTAAACAAAACATGG + Intergenic
1199493215 X:148424113-148424135 GGTCTGAATAGAACAAAAGGTGG - Intergenic
1199514569 X:148661888-148661910 TGTCTAAAATAACAAAAAGATGG - Exonic
1200501436 Y:3955276-3955298 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1201076224 Y:10191506-10191528 GTTCAAAATAAACCAAAAACTGG - Intergenic
1201233644 Y:11889968-11889990 GGTATAAGTAAACAAGAAGAGGG + Intergenic
1201937760 Y:19426077-19426099 GGTATAAGTAAACAAGAAGAGGG - Intergenic