ID: 1067026695 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:42848356-42848378 |
| Sequence | AGTTATCTGCTGAGGATGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1067026690_1067026695 | 26 | Left | 1067026690 | 10:42848307-42848329 | CCCAAGAATGATCAATAAAATAA | 0: 27 1: 678 2: 957 3: 288 4: 1461 |
||
| Right | 1067026695 | 10:42848356-42848378 | AGTTATCTGCTGAGGATGGCAGG | No data | ||||
| 1067026691_1067026695 | 25 | Left | 1067026691 | 10:42848308-42848330 | CCAAGAATGATCAATAAAATAAA | 0: 26 1: 582 2: 739 3: 585 4: 1637 |
||
| Right | 1067026695 | 10:42848356-42848378 | AGTTATCTGCTGAGGATGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1067026695 | Original CRISPR | AGTTATCTGCTGAGGATGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||