ID: 1067026695

View in Genome Browser
Species Human (GRCh38)
Location 10:42848356-42848378
Sequence AGTTATCTGCTGAGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067026690_1067026695 26 Left 1067026690 10:42848307-42848329 CCCAAGAATGATCAATAAAATAA 0: 27
1: 678
2: 957
3: 288
4: 1461
Right 1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG No data
1067026691_1067026695 25 Left 1067026691 10:42848308-42848330 CCAAGAATGATCAATAAAATAAA 0: 26
1: 582
2: 739
3: 585
4: 1637
Right 1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067026695 Original CRISPR AGTTATCTGCTGAGGATGGC AGG Intergenic
No off target data available for this crispr