ID: 1067028450

View in Genome Browser
Species Human (GRCh38)
Location 10:42864569-42864591
Sequence GCTCCTGGCAAGGCACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067028450_1067028457 18 Left 1067028450 10:42864569-42864591 CCTGGTTGTGCCTTGCCAGGAGC No data
Right 1067028457 10:42864610-42864632 GAGTGTCATGAGCTCAGTGGTGG No data
1067028450_1067028456 15 Left 1067028450 10:42864569-42864591 CCTGGTTGTGCCTTGCCAGGAGC No data
Right 1067028456 10:42864607-42864629 TGAGAGTGTCATGAGCTCAGTGG No data
1067028450_1067028458 29 Left 1067028450 10:42864569-42864591 CCTGGTTGTGCCTTGCCAGGAGC No data
Right 1067028458 10:42864621-42864643 GCTCAGTGGTGGTAGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067028450 Original CRISPR GCTCCTGGCAAGGCACAACC AGG (reversed) Intergenic
No off target data available for this crispr