ID: 1067029008

View in Genome Browser
Species Human (GRCh38)
Location 10:42867973-42867995
Sequence CTCAGATTCCCCCCATTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067029008_1067029013 6 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029013 10:42868002-42868024 GGAAAGGAAGACACAGGCCACGG No data
1067029008_1067029016 19 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029016 10:42868015-42868037 CAGGCCACGGAGAGGGCAGCTGG No data
1067029008_1067029015 12 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029015 10:42868008-42868030 GAAGACACAGGCCACGGAGAGGG No data
1067029008_1067029014 11 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029014 10:42868007-42868029 GGAAGACACAGGCCACGGAGAGG No data
1067029008_1067029011 -10 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029011 10:42867986-42868008 GGAATCTGAGGCATCAGGAAAGG No data
1067029008_1067029020 27 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029020 10:42868023-42868045 GGAGAGGGCAGCTGGGCCCTGGG No data
1067029008_1067029019 26 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029019 10:42868022-42868044 CGGAGAGGGCAGCTGGGCCCTGG No data
1067029008_1067029017 20 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029017 10:42868016-42868038 AGGCCACGGAGAGGGCAGCTGGG No data
1067029008_1067029012 0 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029012 10:42867996-42868018 GCATCAGGAAAGGAAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067029008 Original CRISPR CTCAGATTCCCCCCATTCTC TGG (reversed) Intergenic
No off target data available for this crispr