ID: 1067029016

View in Genome Browser
Species Human (GRCh38)
Location 10:42868015-42868037
Sequence CAGGCCACGGAGAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067029008_1067029016 19 Left 1067029008 10:42867973-42867995 CCAGAGAATGGGGGGAATCTGAG No data
Right 1067029016 10:42868015-42868037 CAGGCCACGGAGAGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067029016 Original CRISPR CAGGCCACGGAGAGGGCAGC TGG Intergenic
No off target data available for this crispr