ID: 1067031520

View in Genome Browser
Species Human (GRCh38)
Location 10:42880941-42880963
Sequence GGGGCACGCAACCTCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067031509_1067031520 8 Left 1067031509 10:42880910-42880932 CCCTCCTGCTCCCTGGGCTGAGC No data
Right 1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG No data
1067031511_1067031520 4 Left 1067031511 10:42880914-42880936 CCTGCTCCCTGGGCTGAGCCAGC No data
Right 1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG No data
1067031514_1067031520 -3 Left 1067031514 10:42880921-42880943 CCTGGGCTGAGCCAGCCCAAGGG No data
Right 1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG No data
1067031510_1067031520 7 Left 1067031510 10:42880911-42880933 CCTCCTGCTCCCTGGGCTGAGCC No data
Right 1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG No data
1067031503_1067031520 27 Left 1067031503 10:42880891-42880913 CCTCCACGTGGTGCTGGCCCCCT No data
Right 1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG No data
1067031504_1067031520 24 Left 1067031504 10:42880894-42880916 CCACGTGGTGCTGGCCCCCTCCT No data
Right 1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG No data
1067031512_1067031520 -2 Left 1067031512 10:42880920-42880942 CCCTGGGCTGAGCCAGCCCAAGG No data
Right 1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG No data
1067031508_1067031520 9 Left 1067031508 10:42880909-42880931 CCCCTCCTGCTCCCTGGGCTGAG No data
Right 1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG No data
1067031507_1067031520 10 Left 1067031507 10:42880908-42880930 CCCCCTCCTGCTCCCTGGGCTGA No data
Right 1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067031520 Original CRISPR GGGGCACGCAACCTCTGAGC TGG Intergenic
No off target data available for this crispr